Astrantia major
speciesAt a glance
Occurrence records92 066
Data sources12
Biological traits38
DNA specimens7
eDNA detections6
Sources12 archives
Databases and archives Astrantia major's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility92 066 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics7 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources38 traits
Chemical compositionLOTUS · NPASS59 compounds
Occurrence & distributionGBIF92 066 records
Environmental DNA1 datasets · 1 countries6 detections
DNA & barcodingBOLD · NCBI7 specimens
Genome at a glanceCCDB1.2 Gbp
01Narrative
La Grande astrance, encore appelée Grande radiaire, est une espèce de plantes à fleurs de la famille des Apiaceae (Ombellifères). C'est une plante herbacée vivace trouvée en Europe.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass444 mg
Leaf size10 016 mm²
Plant height0.525 m
⚠ sources differ — GIFT: 0.525 m · LEDA: 0.525 m · TRY: 0.374 m
Plant height generative0.29 m
Plant height max1 m
Plant height min0.3 m
Seed length6.5 mm
Seed mass3.27 mg
⚠ sources differ — TRY: 3.27 mg · LEDA: 2.87 mg · GIFT: 2.99 mg
Seed mass max3.19 mg
Seed mass min2.7 mg
Life cycle & reproduction11
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typeself
⚠ sources differ — LEDA: boleochor · GIFT: anemochorous
Flowering endAug
Flowering startJul
Life formperennial
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Seed number41 293
Self fertilizationabsent
Diet & foraging1
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Habitat GIFTforest, forest edges, meadows, roadsides
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio14.82 g/g
Leaf c455 mg/g
Leaf dry-matter content (LDMC)174 mg/g
Leaf n28.73 mg/g
Leaf p2.83 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)40.63 mm²/mg
⚠ sources differ — TRY: 40.63 mm²/mg · LEDA: 24.5 mm²/mg · GIFT: 24.51 mm²/mg
Other traits1
Diaspore typemericarp
03Chemical composition59 compounds
Compounds documented for Astrantia major across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Lupane triterpenoids9
Oleanane triterpenoids7
Gallotannins4
Farnesane sesquiterpenoids4
Dimeric phloroglucinols3
Documented compounds59 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Betulonic acid | present | NPASS | |
| (14S,15R,19R)-14-[(10R,11S)-3,4,5,11,17,18,19-heptahydroxy-8,14-dioxo-9,13-dioxatricyclo[13.4.0.02,7]nonadeca-1(19),2,4,6,15,17-hexaen-10-yl]-2,3,4,7,8,9,19-heptahydroxy-13,16-dioxatetracyclo[13.3.1.05,18.06,11]nonadeca-1,3,5(18),6,8,10-hexaene-12,17-dione | present | NPASS | |
| (14S,15S,19S)-14-[(10S,11S)-3,4,5,11,17,18,19-heptahydroxy-8,14-dioxo-9,13-dioxatricyclo[13.4.0.02,7]nonadeca-1(19),2,4,6,15,17-hexaen-10-yl]-2,3,4,7,8,9,19-heptahydroxy-13,16-dioxatetracyclo[13.3.1.05,18.06,11]nonadeca-1,3,5(18),6,8,10-hexaene-12,17-dione | present | NPASS | |
| (1R,3aR,5aR,5bR,7aR,9S,11aR,11bS,13aR,13bR)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-ol | present | NPASS | |
| (1S,2S,20S,42S,46R)-7,8,9,12,13,14,25,26,27,30,31,32,35,36,37,46-hexadecahydroxy-3,18,21,41,43-pentaoxanonacyclo[27.13.3.138,42.02,20.05,10.011,16.023,28.033,45.034,39]hexatetraconta-5,7,9,11,13,15,23,25,27,29(45),30,32,34(39),35,37-pentadecaene-4,17,22,40,44-pentone | present | NPASS | |
| (2,6-Dimethyl-10-methylidenedodeca-2,6,11-trienyl) acetate | present | LOTUS | |
| (2E,6E)-2,6-dimethyl-10-methylidenedodeca-2,6,11-trien-1-ol | present | LOTUS | |
| (3S,4aR,6aR,6bS,8aR,11R,12S,12aS,14aR,14bR)-4,4,6a,6b,8a,11,12,14b-octamethyl-2,3,4a,5,6,7,8,9,10,11,12,12a,14,14a-tetradecahydro-1H-picen-3-ol | present | NPASS | |
| (4aS,6aR,6aS,6bR,8aR,10R,12aR,14bR)-10-hydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | NPASS | |
| (4S)-4-[(E,3R)-3-hydroxybut-1-enyl]-3,5,5-trimethylcyclohex-2-en-1-one | present | NPASS |
05DNA & barcoding7 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astrantia major has left across the world's sequence archives.
At a glance
DNA specimens7
Marker genes6
GenBank sequences6
eDNA detections6
Countries1
The DNA barcodea real sequence read deposited for this species
TCGATGCCTGCGAAGCTAAACGACCCGCGAACACGTCAAAAACAGCGGGGGAGCATTTGGGGTACGCAAGTCCCCAGGTTCAGCGACCTC …
Astrantia major specimen-voucher J.L. Benito s.n. (JACA) internal transcribed spacer 1, 5.8S ribosomal RNA gene; and internal transcribed spacer 2, complete sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL3★rbcLa★ITS2★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Astrantia major carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 212 720 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Astrantia major1.21 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidypolyploid inferred
Chromosome records14–282n range28median28mode30records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2822×CCDB · slov-fl · CCDB · iber-fl · CCDB · fl-europaea +7
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 307-314. Bernal, M. & J. Montserrat Mart.Anales Jard. Bot. Madrid41(2): 445-448(1985).
CCDB · fl-europaea — Baksay, 1957b
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov. Ser. Bot. 14, 55-102.
CCDB · book-ipcn65 — Favarger 1965a
CCDB · ipcn-api-dl — Pashuk, K. T. 1987. Chromosome numbers in species of subalpine belt of Chernogora (Ukrainian Carpatians). Bot. Zhurn. 72: 1069–1074.
CCDB · ipcn-api-dl — Wetschnig, W. & G. H. Leute. 1991. Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457–481.
CCDB · ipcn-api-dl — Baltisberger, M. & W. Huber. 1993. IOPB chromosome data 5. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 20: 4–6.
CCDB · ipcn-api-dl — Druskovic, B. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 11–14.
CCDB · ipcn-api-dl — Wörz, A. 2001. On the intraspecific classification of Astrantia major L. (Apiaceae---Saniculoideae). Bot. Jahrb. Syst. 123(3): 303–319.
CCDB · book-ipcn67-71 — FAVARGER, C., & P. KUPFER. 1968. Contribution a la cytotaxinomie de la flore alpine des Pyrenees. Collect. Bot. 7: 325-352.
CCDB · book-ipcn67-71 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1971. In IOPB chromosome number reports XXXIV. Taxon 20: 785-797:-
CCDB · book-ipcn73-74 — LEUTE, G.-H. 1973. Chromosomenzahlen dreier Apiaceen aus Osterreicb oesterr. Bot. z. 121: 143-144. I
CCDB · book-fedorov — Baksay 1957h
CCDB · book-fedorov — Favarger 1965a
CCDB · CromoCat 2015 — Bernal, M. & Montserrat Martí, J. M. (1985). Números cromosomáticos de plantas occidentales, 307-314. Anales Jard. Bot. Madrid 41(2): 445-448.
CCDB · CromoCat 2015 — Druskovic, B. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 11-14.
CCDB · CromoCat 2015 — Favarger, C. & Küpfer, P. (1968). Contribution à la cytotaxonomie de la flore alpine des Pyréneés. Collect. Bot. (Barcelona) 7(1): 325-357.
CCDB · CromoCat 2015 — Leute, G. -H. (1973). Chromosomenzahlen dreier Apiaceen aus österreich. Österr. Bot. Z. 121(1/2):143-144
CCDB · CromoCat 2015 — Wetschnig, W. & G. H. Leute. (1991). Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457-481.
CCDB · CromoCat 2015 — Lovka, M., Susnik, F., Löve, A. & Löve, D. (1971). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXIV]. Taxon 20(5/6): 788-791.
2n 148×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants +1
CCDB · ipcn-api-dl — Alexeeva, T. V., M. G. Vasil'eva, J. V. Daushkevich & M. G. Pimenov. 1994. IOPB chromosome data 8. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 23: 11–12.
CCDB · book-fedorov — Wanschei- 1932
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — HAkansson 1953
CCDB · book-fedorov — Garde, Malheiros-Gardc 1!l54
CCDB · book-fedorov — KopAIQM 19676
CCDB · book-atlas-flowering-plants — Wanscher 1932
CCDB · CromoCat 2015 — Alexeeva, T. V., Vasileva, M. G., Daushkevich, J. V. & Pimenov, M. G. (1994). IOPB Chromosome Data 8 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 23 : 11-12.
n 147×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +1
CCDB · ipcn-api-dl — Wetschnig, W. & G. H. Leute. 1991. Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457–481.
CCDB · ipcn-api-dl — LEUTE, G. H. 1977. In IOPB chromosome number reports LVII. Taxon 26: 443–452.
CCDB · book-ipcn67-71 — KORDYUM, E. L. 1967. Cyto-embryology of Umbellates. (In Russian). Naukova Dumka, Kiev, 1967, 128pp.
CCDB · book-ipcn73-74 — LEUTE, G.-H. 1973. Chromosomenzahlen dreier Apiaceen aus Osterreicb oesterr. Bot. z. 121: 143-144. I
CCDB · CromoCat 2015 — Leute, G. -H. (1973). Chromosomenzahlen dreier Apiaceen aus österreich. Österr. Bot. Z. 121(1/2):143-144
CCDB · CromoCat 2015 — Leute, G. -H. (1977). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVII]. Taxon 26(4): 450-451.
CCDB · CromoCat 2015 — Wetschnig, W. & G. H. Leute. (1991). Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457-481.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type92 066 records
Wild obs. + sensor86 913
Museum / vouchered3 601
Cultivated / captive20
Other1 532
Origin
Native8
Introduced390
Range
Area of Occupancy AOO80 428 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy53% within 1 km
≤100 m 20 475≤1 km 12 427≤10 km 28 493>10 km 453
61 848 georeferenced · 25 065 without coordinates
Open the mapobservation + sensor86 913
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy39% within 1 km
≤100 m 313≤1 km 608≤10 km 1 419>10 km 43
2 383 georeferenced · 1 218 without coordinates
Open the institutions mapphysical evidence3 601
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy56% within 1 km
≤100 m 1≤1 km 4≤10 km 1>10 km 3
9 georeferenced · 11 without coordinates
Open the mapnot free-living20
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions54 of 116 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 179 |
| BFLlocation not on record | 406 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 200 |
| BRNUlocation not on record | 126 |
| Salzburg, AT | 120 |
| Lausanne, CH | 119 |
| LDlocation not on record | 82 |
| GZUlocation not on record | 72 |
| No collectionlocation not on record | 72 |
| Adam Mickiewicz University in Poznańlocation not on record | 62 |
| MAlocation not on record | 61 |
| Vitoria, ES | 49 |
| València, ES | 44 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 39 |
| Oskarshamn, SE | 37 |
| Bern, CH | 36 |
| Barcelona, ES | 36 |
| BDBClocation not on record | 32 |
| Moscow State Universitylocation not on record | 32 |
| Olocation not on record | 32 |
| Zürich, CH | 31 |
| Görlitz, DE | 31 |
| LfUlocation not on record | 26 |
| BClocation not on record | 25 |
| Trondheim, NO | 25 |
| Entomological Society of Latvialocation not on record | 24 |
| SLU Artdatabankenlocation not on record | 21 |
| MeiseBGlocation not on record | 21 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 20 |
| Uniwersytet Śląski w Katowicachlocation not on record | 20 |
| Wlocation not on record | 19 |
| Zürich, CH | 19 |
| Uppsala, SE | 18 |
| KMNlocation not on record | 18 |
| Mlocation not on record | 17 |
| Tartu, EE | 17 |
| Karlsruhe, DE | 14 |
| Helsinki, FI | 14 |
| Provincia di Livornolocation not on record | 14 |
| Porrentruy, CH | 13 |
| DBF-NHMDlocation not on record | 13 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 11 |
| Edinburgh, GB | 11 |
| Salamanca, ES | 10 |
| TROMlocation not on record | 10 |
| CICYTEXlocation not on record | 8 |
| SZUlocation not on record | 8 |
| Palacký University in Olomouclocation not on record | 8 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| Philadelphia, US | 7 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| Madrid, ES | 7 |
| Dresden, DE | 7 |
| Uniwersytet Opolskilocation not on record | 7 |
| Bourges, FR | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 6 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 6 |
| GJOlocation not on record | 6 |
| Bergen, NO | 5 |
| Badajoz, ES | 5 |
| Alicante, ES | 5 |
| Berlin, DE | 5 |
| College of the Atlantic, Museumlocation not on record | 5 |
| Museo Achille Folettolocation not on record | 5 |
| Granada, ES | 5 |
| Glarus, CH | 5 |
| CJBGlocation not on record | 4 |
| Kuopio, FI | 4 |
| Stockholm, SE | 4 |
| Pamplona, ES | 4 |
| Natural History Museum Rotterdamlocation not on record | 4 |
| South Kensington, GB | 3 |
| Gijón, ES | 3 |
| Paris, FR | 3 |
| PRClocation not on record | 3 |
| Frankfurt am Main | 3 |
| Oulu, FI | 3 |
| Vancouver, CA | 3 |
| WTUlocation not on record | 2 |
| Jyväskylä, FI | 2 |
| OLAlocation not on record | 2 |
| BSBIlocation not on record | 2 |
| Uniwersytet Warszawskilocation not on record | 2 |
| Jaén, ES | 2 |
| SNSNMClocation not on record | 2 |
| BG-NMNHSlocation not on record | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Podgorica, ME | 2 |
| Saint Louis, US | 2 |
| Sion, CH | 2 |
| Turku, FI | 2 |
| Denver, US | 2 |
| Royal Botanical Gardenslocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| Dekalb, US | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Porvoo, FI | 1 |
| Santa Barbara, US | 1 |
| Sant Julià de Lòria, AD | 1 |
| Universidade Federal de Juiz de Foralocation not on record | 1 |
| Boumlocation not on record | 1 |
| Bloomington, US | 1 |
| IPE-CSIClocation not on record | 1 |
| Québec, CA | 1 |
| Auckland, NZ | 1 |
| PUC-RSlocation not on record | 1 |
| ESP109location not on record | 1 |
| nbflocation not on record | 1 |
| BIO-UNIPIlocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| University of Hulllocation not on record | 1 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 1 |
| Madrid, ES | 1 |
| Philadelphia, US | 1 |
| Tallinn, EE | 1 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 1 |
116 institutions · 3 522 of 3 601 vouchered records shown · 69 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA6 detections
Where the DNA of Astrantia major was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found6
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 6 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.7 °C 12.7–12.7
Seasonal swing summer↔winter16.4 °C
Max temp (day)14.2 °C
Min temp (night)9.70 °C
Precipitation140 mm/mo
Air humidity64.2 %
Moisture balance44.2 mm/mo
Vapour deficit527 Pa
Wind speed3.30 m/s
Cloud cover64.5 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.