Astranthium integrifolium

(Michx.) Nutt. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Astranthium

At a glance

Occurrence records344

Data sources10

Biological traits8

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Astranthium integrifolium's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility344 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF344 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 8

01Narrative

Astranthium integrifolium, the entireleaf western daisy or eastern western-daisy, is a North American species of flowering plants in the family Asteraceae. It is native to the east-central part of the United States primarily the Cumberland Plateau and Ohio/Tennessee Valley. It is found in the States of Tennessee, Kentucky, Alabama, and Georgia, with isolated populations in Mississippi and West Virginia.Biota of North America Program 2014 county distribution mapNesom, G. L. 2005c. Taxonomic review of Astranthium integrifolium (Asteraceae: Astereae). Sida 21: 2015–2021.De Jong, D. C. D. 1965. A systematic study of the genus Astranthium (Compositae, Astereae). Publications of the Museum of Michigan State University, Biological Series 2: 429–528. Astranthium integrifolium is an annual, usually with an unbranched stem up to 50 cm (20 inches) tall. Flower heads are usually borne one at a time, with white or bluish ray florets and yellow disc florets.Flora of North America, Eastern western-daisy, Astranthium integrifolium (Michaux) Nuttall, Trans. Amer. Philos. Soc., n. s. 7: 312. 1840. Its natural habitat is in limestone glades and barrens, and thin rocky woodlands.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astranthium integrifolium has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF046984.1 ↗627 bp

ACGT

TCGAAGCCTGCAAAGCAGAACGACCCGCGAACACGTTACAACAACCATGCCAAGATGGGTCGGGCATTAGTTCGATCCTCGTGGTACAAC …

Astranthium integrifolium internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Astranthium integrifolium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 8 n = 4

Ploidydiploid inferred

Chromosome records8–182n range8median8mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 84×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · eflora +1

CCDB · book-ipcn65 — DeJong 1965

CCDB · ipcn-api-dl — Morton, J. K. 1981. Chromosome numbers in Compositae from Canada and the U.S.A. Bot. J. Linn. Soc. 82: 357–368.

CCDB · eflora

CCDB · book-atlas-flowering-plants — Baldwin 1941b

2n 181×CCDB · book-fedorov

CCDB · book-fedorov — Negodi 193~, 1937h, i

n 41×CCDB · book-ipcn65

CCDB · book-ipcn65 — DeJong 1965

n 181×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Sharma 1970

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.440 ↗

08Occurrence & distribution

Record type344 records

Wild obs. + sensor148

Museum / vouchered196

Origin

Native2

Range

Area of Occupancy AOO916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 76≤1 km 7≤10 km 2>10 km 30

115 georeferenced · 33 without coordinates

Open the mapobservation + sensor148

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 16≤1 km 21≤10 km 59>10 km 10

106 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence196

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	65
Chapel Hill, US	30
Bangkok, TH	15
Austin, US	15
Chongqing Museumlocation not on record	10
Bloomington, US	8
Fort Worth, US	6
Emporia, US	5
EL PASO, US	4
Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record	4
Wuzhou, CN	3
Jena Microbial Resource Collectionlocation not on record	2
Denton, US	2
Richmond, US	2
Riverside, US	2
GAlocation not on record	2
Porto Alegre, BR	1
Knoxville, US	1
Austin, US	1
Fayetteville, US	1
Linares, MX	1
China Agricultural Universitylocation not on record	1
Burlington, US	1
Northridge, US	1
Moscow, US	1
Saint Louis, US	1
San Luis Obispo, US	1
Dover, US	1
Washington, US	1
DOI/NPS, Greenbelt Parklocation not on record	1
San Angelo, US	1
Stephenville, US	1
Elikins, US	1
Bozeman, US	1
Durham, US	1

35 institutions · 194 of 196 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Astranthium integrifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)