Astragalus xiphidium — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records16

Data sources4

Biological traits10

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Astragalus xiphidium's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF16 records

DNA & barcodingNCBIsequences

01Narrative

Astragalus maraziensis adalah spesies tumbuhan yang tergolong ke dalam famili Fabaceae. Spesies ini juga merupakan bagian dari ordo Fabales. Spesies Astragalus maraziensis sendiri merupakan bagian dari genus Astragalus. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Rzazade.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology2

Plant height max0.5 m

Plant height min0.3 m

Life cycle & reproduction4

Flowering endJul

Flowering startMay

Life formsubshrub

Life spanperennial

Habitat & environment4

Climatetemperate

Growth formherb

Habitat GIFTmountains, stony places

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus xiphidium has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSAB721949.1 ↗596 bp

ACGT

TCGATGCCTTACATGCAGACCAACTCGTGAATTTGTTTGAATACATAGGGATGGCACGGGTGTTTTGGCACCACGGCCTCCCTTTGGGTA …

Astragalus xiphidium gene for ITS1, 5.8S rRNA and ITS2, complete sequence, specimen_voucher: TARI:7611

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type16 records

Wild obs. + sensor6

Museum / vouchered10

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 4 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	4
Wlocation not on record	3
BRNUlocation not on record	2
Bronx, US	1

4 institutions · 10 of 10 vouchered records shown