Astragalus whitneyi — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records861

Data sources10

Biological traits13

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Astragalus whitneyi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility861 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF861 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Astragalus whitneyi is een soort uit de vlinderbloemenfamilie. De soort komt voor in het Cascadegebergte, gelegen in het westen van de Verenigde Staten.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass4.76 mg

Seed mass max4.76 mg

Seed mass min4.54 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition2 compounds

Compounds documented for Astragalus whitneyi across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Indolizidine alkaloids2

Documented compounds2 total

Compound	Class	Amount	Source
Swainsonine		present	LOTUS
swainsonine N-oxide		present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus whitneyi has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSKT202460.1 ↗661 bp

ACGT

TGAACCTGCGGAAGGANCATTGTCGATGCCTTACATGCAGACCAACTCGTGAATTTGTTTGAATACATAGGGATGGCACGGGTGTTTTGG …

Astragalus whitneyi var. confusus isolate JZ-061 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Astragalus whitneyi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 111×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Spellenberg, R. 1981. Chromosome numbers and their cytotaxonomic significance for North American Astragalus (Fabaceae). Taxon 25: 463–472.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type861 records

Wild obs. + sensor676

Museum / vouchered185

Range

Area of Occupancy AOO1 584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 407≤1 km 59≤10 km 24>10 km 19

509 georeferenced · 167 without coordinates

Open the mapobservation + sensor676

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 8≤1 km 56≤10 km 56>10 km 2

122 georeferenced · 63 without coordinates

Open the institutions mapphysical evidence185

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	22
Moscow, US	15
LDlocation not on record	11
WTUlocation not on record	10
Davis, US	10
Boise, US	8
Pocatello, US	8
Riverside, US	8
Caldwell, US	6
Arcata, US	5
Corvallis, US	4
Canadian Department of Agriculturelocation not on record	4
Los Angeles, US	3
Bangkok, TH	3
Angwin, US	3
CASlocation not on record	2
DOI/NPS, Greenbelt Parklocation not on record	2
Severin-McDaniel Insect Collectionlocation not on record	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
San Diego, US	2
Portland, US	2
Bronx, US	2
Bend, US	2
EL PASO, US	2
Flagstaff, US	2
US	2
San Luis Obispo, US	1
University of Stellenboschlocation not on record	1
Long Beach, US	1
Bozeman, US	1
San Jose, US	1
Chadron, US	1
San Francisco, US	1
New Haven, US	1
Vancouver, CA	1
INFlocation not on record	1

36 institutions · 152 of 185 vouchered records shown · 33 without an institution code