Astragalus varius

S.G.Gmel. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records1 983

Data sources10

Biological traits13

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Astragalus varius's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 983 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS9 compounds

Occurrence & distributionGBIF1 983 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Астрагал изменчивый — вид растений рода Астрагал (Astragalus) семейства Бобовые (Fabaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.55 m

Plant height min0.3 m

Life cycle & reproduction5

Flowering endAug

Flowering startMay

Life formperennial or subshrub

Life spanperennial

Raunkiær life formchamaephyte

Habitat & environment5

Aquaticterrestrial

Climatetemperate

Growth formherb

Habitat GIFTdesert, forest, inhabited places, meadows, rivers, sand, semidesert, steppe

Woodinessnon-woody

Physiology & chemistry1

Leaf dry-matter content (LDMC)338 mg/g

03Chemical composition9 compounds

Compounds documented for Astragalus varius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols9

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one	present	LOTUS
5,7-dihydroxy-2-(3-hydroxy-4-methoxyphenyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one	present	LOTUS
Astragalin	present	LOTUS
Feruloyl isoquercitrin 4'-glucoside	present	LOTUS
Isorhamnetin 3-beta-D-glucoside	present	LOTUS
Kaempferol	present	LOTUS
Kaempferol 7-glucoside	present	LOTUS
Narcissin	present	LOTUS
Quercetin	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus varius has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences9

eDNA detections3

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPQ412248.1 ↗355 bp

ACGT

CATAGGGATGGCACGGGTGTTTTGGCACCACGACCTCCCTTTGGGTAGGAGGGGGTGCGTCCCCCTCTTGCCTAAACACAAACCCCGGCG …

Astragalus varius voucher KS23 HER0427 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Astragalus varius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Pavlova, D. K. & S. I. Kozhuharov. 1993. Chromosome numbers of Bulgarian angiosperms. Fitologija 44: 75.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 983 records

Wild obs. + sensor1 388

Museum / vouchered592

Other3

Origin

Native5

Range

Area of Occupancy AOO4 852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 732≤1 km 231≤10 km 66>10 km 51

1 080 georeferenced · 308 without coordinates

Open the mapobservation + sensor1 388

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 68≤1 km 67≤10 km 173>10 km 25

333 georeferenced · 259 without coordinates

Open the institutions mapphysical evidence592

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	300
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	71
Voronezh State Universitylocation not on record	40
LDlocation not on record	22
BRNUlocation not on record	8
Samara National Research Universitylocation not on record	7
Wlocation not on record	5
Mlocation not on record	2
BClocation not on record	2
Dresden, DE	1
Berlin, DE	1
Minia, EG	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
GZUlocation not on record	1
South Kensington, GB	1

15 institutions · 463 of 592 vouchered records shown · 126 without an institution code

09Environmental DNA3 detections

Where the DNA of Astragalus varius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 11.0–11.0

Seasonal swing summer↔winter22.3 °C

Max temp (day)15.3 °C

Min temp (night)6.70 °C

Precipitation47.9 mm/mo

Air humidity59.3 %

Moisture balance-24.0 mm/mo

Vapour deficit629 Pa

Wind speed2.70 m/s

Cloud cover45.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Astragalus varius

At a glance

Sources10 archives

Size & morphology2

Life cycle & reproduction5

Habitat & environment5

Physiology & chemistry1

Compound class profile1 class

Documented compounds9 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 983 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 983 records