Astragalus trichopodus

(Nutt.) A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records2 346

Data sources11

Biological traits12

DNA specimens11

eDNA detections8

Sources11 archives

Databases and archives Astragalus trichopodus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 346 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF2 346 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Astragalus trichopodus is a species of legume known by the common name Santa Barbara milk vetch. It is native to southern California and Baja California, where it grows in several types of open habitat, including in the Transverse Ranges and Mojave Desert.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass2.24 mg

Seed mass max2.27 mg

Seed mass min2.27 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: non-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus trichopodus has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes5

GenBank sequences10

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSGU217638.1 ↗212 bp

ACGT

CATATCGTTGCTCGATGCCTATCGCATTGCGATAGGACTTAGGGCGAATGATGGCTTCCCGTGAGCGTTGTTGCCTCGCGGTTGGTTGAA …

Astragalus trichopodus voucher PS0273MT03 internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL1★rbcLa★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Astragalus trichopodus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 113×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · Cave1959

CCDB · book-ipcn65 — Raven et al. 1965

CCDB · ipcn-api-dl — Spellenberg, R. 1981. Chromosome numbers and their cytotaxonomic significance for North American Astragalus (Fabaceae). Taxon 25: 463–472.

CCDB · Cave1959 — Snow 1959

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.996 ↗

08Occurrence & distribution

Record type2 346 records

Wild obs. + sensor2 131

Museum / vouchered215

Origin

Native29

Range

Area of Occupancy AOO2 608 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 1 252≤1 km 157≤10 km 44>10 km 229

1 682 georeferenced · 449 without coordinates

Open the mapobservation + sensor2 131

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 41≤1 km 30≤10 km 21>10 km 8

100 georeferenced · 115 without coordinates

Open the institutions mapphysical evidence215

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Riverside, US	39
Claremont, US	31
Santa Barbara, US	20
ASUlocation not on record	15
Arizona State University Biocollectionslocation not on record	13
San Diego, US	10
US	9
LDlocation not on record	7
Bronx, US	6
Irvine, US	5
Phoenix, US	5
Ann Arbor, US	4
Severin-McDaniel Insect Collectionlocation not on record	4
EL PASO, US	3
San Luis Obispo, US	3
Canadian Department of Agriculturelocation not on record	3
Flagstaff, US	2
Davis, US	2
San Juan College School of Science Math & Engineeringlocation not on record	2
Long Beach, US	2
Ensenada, MX	2
Saint Louis, US	2
US	2
Henderson, US	1
La Paz, MX	1
Logan, US	1
Albuquerque, US	1
Chongqing Museumlocation not on record	1
Jena Microbial Resource Collectionlocation not on record	1
Clemson, US	1
Fullerton, US	1
San Bernardino, US	1
Northridge, US	1
Los Angeles, US	1
Moscow, US	1
Wuzhou, CN	1
Boise, US	1
Bloomington, US	1

38 institutions · 206 of 215 vouchered records shown · 9 without an institution code

09Environmental DNA8 detections

Where the DNA of Astragalus trichopodus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

Coastal Sage Scrub/Riparian with Artemisia c…Maritime Sage Scrub

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 14.1–15.6

Seasonal swing summer↔winter6.70 °C

Max temp (day)16.8 °C 16.3–17.2

Min temp (night)13.0 °C 11.8–14.1

Precipitation23.9 mm/mo 8.50–39.2

Air humidity62.5 % 59.4–65.7

Vapour deficit628 Pa 605–651

Cloud cover31.9 % 27.7–36.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Astragalus trichopodus

At a glance

Sources11 archives

Size & morphology3

Life cycle & reproduction2

Diet & foraging1

Habitat & environment5

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 346 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions30 of 38 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 346 records