Astragalus robbinsii

(Oakes) A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records453

Data sources10

Biological traits9

DNA specimens15

eDNA detections12

Sources10 archives

Databases and archives Astragalus robbinsii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility453 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF453 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD · NCBI15 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Astragalus robbinsii, l'Astragale de Robbins, est une espèce de plantes à fleurs de la famille des Fabaceae. Il s'agit d'une espèce menacée au Québec.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus robbinsii has left across the world's sequence archives.

At a glance

DNA specimens15

Marker genes5

GenBank sequences10

eDNA detections12

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG237549.1 ↗334 bpCanada · 1893

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGTTGAGGGCACGTCTGCCTGGGCGTCACATATC …

Astragalus robbinsii voucher CCDB-20330-B01 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★rbcLa★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Astragalus robbinsii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 321×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — GERVAIS, C., R. Trahan & J. Gagnon. 1999. IOPB chromosome data 14. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 30: 10–15.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type453 records

Wild obs. + sensor276

Museum / vouchered177

Range

Area of Occupancy AOO1 188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 203≤1 km 18≤10 km 10>10 km 5

236 georeferenced · 40 without coordinates

Open the mapobservation + sensor276

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 12≤1 km 23≤10 km 42>10 km 15

92 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence177

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Burlington, US	27
Missoula, US	21
Rocky Mountain Biological Laboratorylocation not on record	16
University of Alberta Museumslocation not on record	15
Université Lavallocation not on record	8
Vancouver, CA	8
Victoria, CA	8
Chongqing Museumlocation not on record	5
Bozeman, US	4
Logan, US	4
University of Lethbridgelocation not on record	4
Anchorage, US	4
Provo, US	3
Pocatello, US	3
LDlocation not on record	3
Research Collection of B. A. Bennettlocation not on record	3
Saint John, CA	3
Moscow, US	3
Denver, US	3
WTUlocation not on record	2
University of British Columbia, Herbariumlocation not on record	2
Acadia Universitylocation not on record	2
Boise, US	2
Caldwell, US	2
US	2
Chicago, US	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
Claremont, US	1
University of Stellenboschlocation not on record	1
Whitehorse, CA	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
CASlocation not on record	1
Yukon Universitylocation not on record	1
Dresden, DE	1
Bronx, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Minia, EG	1
Corvallis, US	1

38 institutions · 170 of 177 vouchered records shown · 7 without an institution code

09Environmental DNA12 detections

Where the DNA of Astragalus robbinsii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 12.2–15.0

Seasonal swing summer↔winter36.8 °C

Max temp (day)18.0 °C 16.4–22.0

Min temp (night)8.90 °C 7.10–9.60

Precipitation67.1 mm/mo 41.2–109

Air humidity53.8 % 53.1–55.6

Moisture balance-55.1 mm/mo -98.2–-0.9

Vapour deficit697 Pa 669–789

Wind speed2.00 m/s 1.70–3.70

Cloud cover39.5 % 35.1–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)