Astragalus racemosus — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records589

Data sources11

Biological traits15

DNA specimens5

eDNA detections2

Sources11 archives

Databases and archives Astragalus racemosus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility589 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF589 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Astragalus racemosus, the cream milkvetch, is a species of flowering plant in the family Fabaceae. It is native to central North America. A selenium hyperaccumulator, it is considered capable of poisoning livestock as one of the locoweeds.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass4.55 mg

Seed mass max5.5 mg

Seed mass min4 mg

Life cycle & reproduction4

Flowering endJun

Flowering startMay

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus racemosus has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences5

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG234699.1 ↗310 bpCanada · 1956

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGTTGAGGGCACGTCTGCCTGGGCGTCACATATC …

Astragalus racemosus voucher CCDB-20330-F02 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL2rbcLaITS3ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Astragalus racemosus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 111×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ward, D. E. & R. W. Spellenberg. 1986. Chromosome counts of angiosperms of western North America. Phytologia 61: 119–125.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type589 records

Wild obs. + sensor306

Museum / vouchered283

Range

Area of Occupancy AOO1 468 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 175≤1 km 38≤10 km 20>10 km 22

255 georeferenced · 51 without coordinates

Open the mapobservation + sensor306

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 12≤1 km 46≤10 km 91>10 km 16

165 georeferenced · 118 without coordinates

Open the institutions mapphysical evidence283

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions31 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Spearfish, US	37
Chadron, US	27
DOI/NPS, Colonial National Historical Parklocation not on record	27
Musee des Dinosaures d'Esperaza (Aude)location not on record	24
Fort Worth, US	13
Claremont, US	13
Austin, US	12
Brookings, US	12
Lubbock, US	11
ASUlocation not on record	10
Chongqing Museumlocation not on record	8
LDlocation not on record	7
Missoula, US	6
Denver, US	6
Albuquerque, US	6
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	5
DOI/NPS, Greenbelt Parklocation not on record	4
US	4
Provo, US	4
Bronx, US	4
Bangkok, TH	4
Jena Microbial Resource Collectionlocation not on record	4
Wuzhou, CN	3
Logan, US	3
Riverside, US	3
Lincoln, US	3
University of Stellenboschlocation not on record	2
Austin, US	2
San Luis Potosí, MX	2
Bloomington, US	2
Saint Louis, US	2
Boise, US	1
EL PASO, US	1
Durango, MX	1
Emporia, US	1
Weber State Universitylocation not on record	1
San Angelo, US	1
Rocky Mountain Biological Laboratorylocation not on record	1
Bozeman, US	1
Paris, FR	1
Phoenix, US	1
Pittsburg, US	1

42 institutions · 281 of 283 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Astragalus racemosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

Ici et la dans le Boutelouetum bordant l'eco…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.