Astragalus pulsiferae

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records31

Data sources5

Biological traits9

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Astragalus pulsiferae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility31 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF31 records

DNA & barcodingNCBIsequences

01Narrative

Astragalus pulsiferae is a species of milkvetch known by the common name Ames's milkvetch. It is native to California and Nevada, and it is known but rare in Washington. It is known from many habitat types, including mountains and plateaus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus pulsiferae has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOL752438.1 ↗668 bpUSA · 1998

ACGT

TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACCAACTCGTGAATTTGTTTGAATACATAGGG …

Astragalus pulsiferae var. pulsiferae isolate CDA-0026736 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type31 records

Wild obs. + sensor4

Museum / vouchered27

Range

Area of Occupancy AOO96 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 1>10 km 1

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤1 km 9≤10 km 4>10 km 1

14 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Angwin, US	2
Pullman, US	2
LDlocation not on record	2
Claremont, US	1
New Haven, US	1
CASlocation not on record	1
Henderson, US	1
Logan, US	1
Bronx, US	1
Phoenix, US	1
San Diego, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Walla Walla, US	1
San Luis Obispo, US	1
Bangkok, TH	1

15 institutions · 18 of 27 vouchered records shown · 9 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)