Astragalus praelongus

E.Sheld. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records673

Data sources11

Biological traits14

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Astragalus praelongus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility673 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF673 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Astragalus praelongus (stinking milkvetch) is a perennial plant in the legume family (Fabaceae) found in the Colorado Plateau and Canyonlands region of the southwestern United States.Canyon Country Wildflowers, Damian Fagan, 2nd ed., 2012, Morris Bush Publishing, LLC. in cooperation with Canyonlands Natural History Association, It's fleshy seedpods become woody with age. It grows in soils containing selenium. A. praelongus var. ellisiae was named for Charlotte Cortlandt Ellis, who collected the holotype specimen in the Sandia Mountains of New Mexico near where she lived.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height0.05 m

Seed mass5.3 mg

⚠ sources differ — TRY: 5.3 mg · GIFT: 4.04 mg

Seed mass max5.3 mg

Seed mass min2.79 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Lifespan years2 years

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition2 compounds

Compounds documented for Astragalus praelongus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Indolizidine alkaloids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Swainsonine		present	LOTUS
swainsonine N-oxide		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus praelongus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF121716.1 ↗597 bp

ACGT

TCGATGCCTTACATGCAGACCAACTCGTGAATTTGTTTGAATACATAGGGATGGCACGGGTGTTTTGGCACCACGACCTCCCTTTGGGTA …

Astragalus praelongus internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Astragalus praelongus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 111×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ward, D. E. 1984. Chromosome counts from New Mexico and Mexico. Phytologia 56(1): 55–60.

n 121×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Spellenberg, R. 1981. Chromosome numbers and their cytotaxonomic significance for North American Astragalus (Fabaceae). Taxon 25: 463–472.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type673 records

Wild obs. + sensor410

Museum / vouchered263

Origin

Native1

Range

Area of Occupancy AOO1 676 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 241≤1 km 43≤10 km 27>10 km 20

331 georeferenced · 79 without coordinates

Open the mapobservation + sensor410

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 15≤1 km 22≤10 km 60>10 km 5

102 georeferenced · 161 without coordinates

Open the institutions mapphysical evidence263

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Flagstaff, US	33
US	33
Claremont, US	25
ASUlocation not on record	25
DOI/NPS, Colonial National Historical Parklocation not on record	23
Phoenix, US	22
Albuquerque, US	14
Provo, US	11
Grand Junction, US	10
Musee des Dinosaures d'Esperaza (Aude)location not on record	10
Durango, US	6
Riverside, US	6
Denver, US	5
LDlocation not on record	4
Orem, US	4
Lubbock, US	3
Boise, US	3
Chadron, US	3
Logan, US	2
Jena Microbial Resource Collectionlocation not on record	2
Pullman, US	2
University of Stellenboschlocation not on record	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
Cslocation not on record	1
Saint Louis, US	1
Moscow, US	1
Bangkok, TH	1
USFSlocation not on record	1
DOI/NPS, Greenbelt Parklocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1
Angwin, US	1
Bronx, US	1
Madison, US	1
Bloomington, US	1
EL PASO, US	1

35 institutions · 262 of 263 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Astragalus praelongus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)