Astragalus osterhoutii

M.E.Jones · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records69

Data sources7

Biological traits9

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Astragalus osterhoutii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility69 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF69 records

DNA & barcodingNCBIsequences

01Narrative

Astragalus osterhoutii, or the Osterhout milkvetch or Kremmling milkvetch is an endangered species of milkvetch, discovered and collected in 1905 at Sulfur Spring in Grand County Colorado by Colorado botanist George Everett Osterhout for which the plant was named. It is found in the U.S. state of Colorado, in a 13 km radius near the town of Kremmling.USDA Kremmling Milkvetch Plant Fact Sheet https://plants.usda.gov/DocumentLibrary/factsheet/pdf/fs_asos.pdf (March 30, 2022) The Osterhout milkvetch is a perennial dicot. It belongs to the pea family, Fabaceae, and is in the Astragalus L. genus. Conservation efforts are centered around maintaining the populations and habitat due to the limited population numbers and limited range.FWS 5-Year Review https://ecos.fws.gov/docs/tess/species_nonpublish/2729.pdf (March 3, 2022)

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus osterhoutii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ439300.1 ↗6 459 bpUSA · 1994

ACGT

CTTGGCACAATGTGGTGTGGTTGCCTACGGATGTCATGCTTAGCGGCGCGGGGAAGGCTCCATCGGATTACTCCATATCCTTGCTATGCC …

Astragalus osterhoutii isolate NDA 20063 5' external transcribed spacer, partial sequence; 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence; and 3' external transcribed spacer, partial sequenc

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type69 records

Wild obs. + sensor52

Museum / vouchered17

Range

Area of Occupancy AOO212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 52

52 georeferenced

Open the mapobservation + sensor52

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 1≤10 km 8

9 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	8
Claremont, US	8
Moscow, US	1

3 institutions · 17 of 17 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)