Astragalus obcordatus

Elliott · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records176

Data sources4

Biological traits9

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Astragalus obcordatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility176 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF176 records

DNA & barcodingNCBIsequences

01Narrative

Astragalus obcordatus adalah spesies tumbuhan yang tergolong ke dalam famili Fabaceae. Spesies ini juga merupakan bagian dari ordo Fabales. Spesies Astragalus obcordatus sendiri merupakan bagian dari genus Astragalus. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Elliott.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus obcordatus has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKY627004.1 ↗561 bp

ACGT

ACAGAGACTAAAGCGAGTGTGGGGTTCAAAGCTGGTGTTAAAGATTATAGATTGACGTATTATACTCCTGAGTATGAAACCAAAGATACT …

Astragalus obcordatus voucher FLAS:Majure 4842 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2

plant barcode

08Occurrence & distribution

Record type176 records

Wild obs. + sensor75

Museum / vouchered101

Range

Area of Occupancy AOO516 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 35≤1 km 5≤10 km 4>10 km 21

65 georeferenced · 10 without coordinates

Open the mapobservation + sensor75

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤1 km 2≤10 km 8>10 km 13

23 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence101

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	28
Bronx, US	26
Tampa, US	14
Chongqing Museumlocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
LDlocation not on record	3
Miami, US	3
ASUlocation not on record	3
Chapel Hill, US	2
Mississippi State, US	2
Chicago, US	1
Tall Timbers Research Stationlocation not on record	1
Columbia, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Bloomington, US	1
BAYLUlocation not on record	1

16 institutions · 94 of 101 vouchered records shown · 7 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)