Astragalus microcephalus

Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records82

Data sources8

Biological traits22

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Astragalus microcephalus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility82 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionLOTUS · NPASS23 compounds

Occurrence & distributionGBIF82 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 32

01Narrative

Astracantha microcephala là một loài thực vật có hoa trong họ Đậu. Loài này được (Willd.) Podlech miêu tả khoa học đầu tiên.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology5

Plant height0.249 m

Plant height max0.4 m

Seed mass2.18 mg

⚠ sources differ — TRY: 2.18 mg · GIFT: 3.35 mg

Seed mass max4.53 mg

Seed mass min2.18 mg

Life cycle & reproduction6

Deciduousnessevergreen

Flowering endAug

Flowering startJun

Life formsubshrub or shrub

Life spanperennial

Lifespan years20 years

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 000 m

Elevation min600 m

Epiphyteterrestrial

Growth formshrub

Habitat GIFThills, stony places

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition23 compounds

Compounds documented for Astragalus microcephalus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Chalcones6

Cucurbitane triterpenoids $ Cycloartane triterpenoids5

Cycloartane triterpenoids4

Aurones2

Flavanones1

Documented compounds23 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3R,4S,5R,6R)-2-[[(1S,3R,6S,8R,9S,11S,12S,14S,15R,16R)-14-hydroxy-15-[(2R,5S)-5-(2-hydroxypropan-2-yl)-2-methyloxolan-2-yl]-7,7,12,16-tetramethyl-6-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxy-9-pentacyclo[9.7.0.01,3.03,8.012,16]octadecanyl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2R,3R,4S,5S,6R)-2-[[(1S,3R,6S,8R,9S,11S,12S,14S,15R,16R)-14-hydroxy-15-[(2S,5S)-5-hydroxy-2,6,6-trimethyloxan-2-yl]-7,7,12,16-tetramethyl-6-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxy-9-pentacyclo[9.7.0.01,3.03,8.012,16]octadecanyl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2R,3R,4S,5S,6R)-2-[[(1S,3R,6S,9S,11S,12S,14S,15R,16R)-6,14-dihydroxy-15-[(2R,5S)-5-(2-hydroxypropan-2-yl)-2-methyloxolan-2-yl]-7,7,12,16-tetramethyl-9-pentacyclo[9.7.0.01,3.03,8.012,16]octadecanyl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
3(2H)-Benzofuranone, 2-[(3,4-dihydroxyphenyl)methylene]-6-hydroxy-	present	LOTUS
7-Hydroxyflavone	present	LOTUS
[(2R,3R,4S,5S)-3-acetyloxy-5-hydroxy-2-[[(1S,3R,6R,8S,9R,11S,12R,14S,15S,16R)-14-hydroxy-15-[(2R,5R)-5-(2-hydroxypropan-2-yl)-2-methyloxolan-2-yl]-7,7,12,16-tetramethyl-9-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-6-pentacyclo[9.7.0.01,3.03,8.012,16]octadecanyl]oxy]oxan-4-yl] acetate	present	LOTUS
Acumitin	present	NPASS
Astragaloside II	present	LOTUS
Astragaloside IV	present	LOTUS
Benzyl benzoate	present	NPASS

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus microcephalus has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOP950203.1 ↗625 bp

ACGT

TGCGGAAGGATCATTGTCGATGCCTTACATGCAGACCAACTCGTGAATTTGTTTGAATACATAGGGATGGCACGGGTGTTTTGGCACCAC …

Astragalus microcephalus voucher LRN-28 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Astragalus microcephalus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Chromosome records16–322n range24median32mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Cartier, D. 1979. Premieres prospections caryologiques du genre Astragalus L. dans la flore du basin mediterraneen oriental. Rev. Cytol. Biol. Vég., Bot. 2: 169–181.

2n 321×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Magulaev, A. J. 1989. Chromosome numbers in some Astragalus (Fabaceae) species of the Caucasus flora. Bot. Žhurn. (Moscow & Leningrad) 74: 1519–1521.

08Occurrence & distribution

Record type82 records

Wild obs. + sensor52

Museum / vouchered30

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 44

44 georeferenced · 8 without coordinates

Open the mapobservation + sensor52

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	11
Wlocation not on record	9
BGBMlocation not on record	6
Bronx, US	2
Berlin, DE	1
BClocation not on record	1

6 institutions · 30 of 30 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)