Astragalus lemmonii

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records90

Data sources5

Biological traits9

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Astragalus lemmonii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility90 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF90 records

DNA & barcodingNCBIsequences

01Narrative

Astragalus lemmonii, the Lemmon's milkvetch, is a rare plant of eastern California. It is a member of the bean family, the Leguminosae (a.k.a. Fabaceae), and specifically a member of the subfamily Papilionoideae (a.k.a. Faboideae). The genus Astragalus is a large genus within this family; members of this genus are known as milkvetches or locoweeds. Close relatives of this particular species include Astragalus peckii and Astragalus lentiformis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus lemmonii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ439283.1 ↗6 468 bpUSA · 2003

ACGT

CTTGGCGCAATGTGGTGTGGTTGCCTTCGGATGTCATGCTTAGCGGCGCGGAGAAGGCTCCATCGGATTACTCCATATCCTTGCTATGCC …

Astragalus lemmonii isolate KC s.n. 5' external transcribed spacer, partial sequence; 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence; and 3' external transcribed spacer, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type90 records

Wild obs. + sensor26

Museum / vouchered64

Range

Area of Occupancy AOO204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤100 m 8≤10 km 1>10 km 17

26 georeferenced

Open the mapobservation + sensor26

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤1 km 15≤10 km 7>10 km 2

24 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	12
Bronx, US	8
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	5
INFlocation not on record	4
CASlocation not on record	3
Davis, US	3
Canadian Department of Agriculturelocation not on record	3
Santa Barbara, US	3
Riverside, US	2
Angwin, US	2
San Jose, US	1
Provo, US	1
Pocatello, US	1
Boise, US	1
WTUlocation not on record	1
San Diego, US	1
University of Stellenboschlocation not on record	1
Pullman, US	1

18 institutions · 53 of 64 vouchered records shown · 11 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)