Astragalus laxmannii

Jacq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records2 406

Data sources9

Biological traits25

DNA specimens12

eDNA detections6

Sources9 archives

Databases and archives Astragalus laxmannii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 406 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Chemical compositionLOTUS11 compounds

Occurrence & distributionGBIF2 406 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI12 specimens

01Narrative

Astragalus laxmannii adalah spesies tumbuhan yang tergolong ke dalam famili Fabaceae. Spesies ini juga merupakan bagian dari ordo Fabales. Spesies Astragalus laxmannii sendiri merupakan bagian dari genus Astragalus. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Jacq..

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Leaf size138 mm²

Plant height0.5 m

Plant height max0.45 m

Plant height min0.1 m

Seed mass1.54 mg

⚠ sources differ — TRY: 1.54 mg · GIFT: 1.63 mg

Seed mass max3.92 mg

Seed mass min0.8 mg

Life cycle & reproduction6

DeciduousnessN

Flowering endJul

Flowering startJun

Life formperennial

Life spanperennial

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, meadows: wet, old fields, rivers, sand, shrubberies, steppe, stony places

Woodinessnon-woody

Physiology & chemistry4

Leaf dry-matter content (LDMC)257 mg/g

Leaf n32.15 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)13.51 mm²/mg

03Chemical composition11 compounds

Compounds documented for Astragalus laxmannii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Chalcones4

Flavonols3

Isoflavanones1

Flavanones1

Cinnamoyl phenols1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-5-hydroxy-7-methoxy-2-(4-methoxyphenyl)-2,3-dihydrochromen-4-one	present	LOTUS
(R)-Mucronulatol	present	LOTUS
2',4'-Dihydroxy-3,4-dimethoxychalcone	present	LOTUS
2',4'-Dihydroxy-4-methoxychalcone	present	LOTUS
Isoliquiritigenin	present	LOTUS
Isorhamnetin 3-beta-D-glucoside	present	LOTUS
Isorhamnetin 3-glucoside 7-rhamnoside	present	LOTUS
Kaempferol 3-O-alpha-L-rhamnoside-beta-D-glucosyl	present	LOTUS
Melilitocarpan B	present	LOTUS

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus laxmannii has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes5

GenBank sequences10

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPX433265.1 ↗583 bpChina · 2023

ACGT

GCAGACCAACTCGTGAATTTGTTTGAATACATAGGGATGGCACGGGTGTTTTGGCACCACGACCTCCCTTTGGGTAGGAGGGGGTGCGTC …

Astragalus laxmannii voucher MHLZU6877 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL2★rbcLa★ITS8★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type2 406 records

Wild obs. + sensor2 284

Museum / vouchered121

Cultivated / captive1

Origin

Native7

Range

Area of Occupancy AOO6 072 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 1 347≤1 km 201≤10 km 75>10 km 104

1 727 georeferenced · 557 without coordinates

Open the mapobservation + sensor2 284

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 1≤1 km 8≤10 km 2>10 km 3

14 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence121

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	12
NSMKlocation not on record	10
Beijing, CN	10
CASlocation not on record	8
Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record	6
Frankfurt am Main	6
Provo, US	6
Moscow State Universitylocation not on record	6
Lincoln, US	5
Denver, US	5
BRNUlocation not on record	3
Vancouver, CA	2
Research Collection of B. A. Bennettlocation not on record	2
Saint Louis, US	2
Bronx, US	2
LDlocation not on record	2
Brookings, US	2
Herbarium of South China Botanical Gardenlocation not on record	2
Logan, US	1
Chadron, US	1
Musee des Dinosaures d'Esperaza (Aude)location not on record	1
Flagstaff, US	1
National Institute of Biological Resourceslocation not on record	1
Kew, GB	1
Wlocation not on record	1
Chongqing Museumlocation not on record	1
Stockholm, SE	1
Boise, US	1
University of British Columbia, Herbariumlocation not on record	1
Tempe, US	1

30 institutions · 103 of 121 vouchered records shown · 18 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Astragalus laxmannii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 4.10–25.9

Seasonal swing summer↔winter40.2 °C

Max temp (day)19.2 °C 7.80–31.8

Min temp (night)9.30 °C -0.1–18.7

Precipitation69.4 mm/mo 16.1–109

Air humidity54.0 % 43.2–61.8

Moisture balance-32.8 mm/mo -146–1.70

Vapour deficit704 Pa 474–1,903

Wind speed2.80 m/s 1.80–6.90

Cloud cover40.1 % 34.6–57.3

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Astragalus laxmannii

At a glance

Sources9 archives

Size & morphology7

Life cycle & reproduction6

Diet & foraging1

Habitat & environment7

Physiology & chemistry4

Compound class profile5 classes

Documented compounds11 total

At a glance

Record type2 406 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 30 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 406 records