Astragalus hypoglottis

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records5 443

Data sources9

Biological traits16

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Astragalus hypoglottis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 443 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF5 443 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Astragalus hypoglottis, l'astragale pourpre, est une espèce de plantes à fleurs de la famille des Fabaceae. C'est une plante herbacée originaire du sud-ouest de l'Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height0.2 m

Plant height max0.4 m

Plant height min0.1 m

Life cycle & reproduction6

Flowering endJul

Flowering startJun

Life formperennial

Life spanperennial

Lifespan years2 years

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus hypoglottis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK945619.1 ↗791 bpFrance

ACGT

GGCGACGTGGGCGGTTCGCTGCCCGCGACGTTGTGAGAAGTCCACTGAACCTATCCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCC …

Astragalus hypoglottis subsp. gremlii voucher M- small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Astragalus hypoglottis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 167×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2

CCDB · ita-fl — LOEVE A. - 1969. IOPB chromosome number reports XXII.. Taxon , 18(4): 433-442.

CCDB · ipcn-api-dl — Afzal-Raf;auu, Z., J. Vianot, M. Ramade & M. P. Bourreil. 1985. Analyses des charactères caryologiques et écologiques de quelques taxons dans les massifs du Lubéron, de Lure et du Mont-Ventoux. Rev. Cytol. Biol. Veg. Bot. 8: 33–62.

CCDB · ipcn-api-dl — Cartier, D. 1976. In IOPB chromosome number reports LIII. Taxon 25: 486–500.

CCDB · book-ipcn67-71 — FAVARGER, c. 1969. In IOPB chromosome number reports XXII. Taxon 18: 433-442.

CCDB · book-ipcn67-71 — FAVARGER, c. 1969. Notes de caryologie Alpine V. Bull. Soc. Neuchateloise Sci. Nat. 92: 13-30.

CCDB · book-ipcn75-78 — Cartier 1976

CCDB · Cave1963 — Led. & Rever 1963

n 81×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Aryavand, A. 1983a. In IOPB chromosome number reports LXXX. Taxon 32: 505.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.988 ↗

08Occurrence & distribution

Record type5 443 records

Wild obs. + sensor5 212

Museum / vouchered212

Other19

Origin

Native143

Range

Area of Occupancy AOO4 620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy10% within 1 km

≤100 m 297≤1 km 182≤10 km 4 101>10 km 47

4 627 georeferenced · 585 without coordinates

Open the mapobservation + sensor5 212

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 6≤1 km 39≤10 km 66>10 km 6

117 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence212

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Barcelona, ES	39
LDlocation not on record	30
BDBClocation not on record	26
BIO-UNIPIlocation not on record	16
BClocation not on record	13
Tallinn, EE	10
MAlocation not on record	6
BRNUlocation not on record	4
Davenport, US	3
Philadelphia, US	2
Mississippi State, US	2
Paris, FR	2
College of the Atlantic, Museumlocation not on record	2
San Sebastián, ES	1
Tartu, EE	1
Claremont, US	1
IPE-CSIClocation not on record	1
Wlocation not on record	1
CICYTEXlocation not on record	1
GJOlocation not on record	1
Philadelphia, US	1
Alicante, ES	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Bangkok, TH	1
The Tula Region State Institution of Culture "Tula Museum Association"location not on record	1

25 institutions · 167 of 212 vouchered records shown · 45 without an institution code

09Environmental DNA1 detections

Where the DNA of Astragalus hypoglottis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Astragalus hypoglottis

At a glance

Sources9 archives

Size & morphology3

Life cycle & reproduction6

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type5 443 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type5 443 records