Astragalus hamosus
speciesAt a glance
Occurrence records9 393
Data sources11
Biological traits45
DNA specimens1
eDNA detections1
Sources11 archives
Databases and archives Astragalus hamosus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility9 393 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics1 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources45 traits
Chemical compositionLOTUS21 compounds
Occurrence & distributionGBIF9 393 records
Environmental DNA1 datasets · 0 countries1 detections
DNA & barcodingBOLD · NCBI1 specimens
Genome at a glanceCCDB2n = 32
01Narrative
Astragalus hamosus, l'Astragale à crochets ou Astragale à gousses en hameçon, est une espèce de plantes à fleurs de la famille des Fabacées. C'est une plante annuelle.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTAusTraitsWCVP
Size & morphology19
Fruit length35 mm
Fruit length max55 mm
Fruit length min15 mm
Fruit width2.5 mm
Fruit width max3.5 mm
Fruit width min1.5 mm
Leaf length27.5 mm
Leaf length max150 mm
Leaf length min6 mm
Leaf width4.5 mm
Leaf width max9 mm
Leaf width min2 mm
Plant height0.2 m
Plant height max0.55 m
Plant height min0.05 m
Seed length1.75 mm
Seed mass2.93 mg
⚠ sources differ — TRY: 2.93 mg · LEDA: 3.1 mg · GIFT: 21.62 mg
Seed mass max144 mg
Seed mass min2.3 mg
Life cycle & reproduction9
Dehiscencedehiscent
Flower colourblue
Flowering endMay
Flowering startMar
Flowering timennnnnnnnyyyn
Life formannual or biennial
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: annual biennial · LEDA: annuals · GIFT: annual
Lifespan years2 years
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Epiphyteterrestrial
Fruit typelegume
Growth formherb
Habitat GIFTmountains, sand, steppe, stony places
Leaf compoundnesscompound
Leaf formimparipinnate
Leaf shapeoblong obovate
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)214 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)15.21 mm²/mg
Other traits2
Plant support typefree-standing
Shoot orientationascending
03Chemical composition21 compounds
Compounds documented for Astragalus hamosus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Aminoacids8
Unsaturated fatty acids4
Branched fatty acids $ Unsaturated fatty acids3
Monosaccharides3
Disaccharides $ Flavones $ Monosaccharides $ Polysaccharides1
Documented compounds21 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2R,3S,4R,5R)-2,3,4,5,6-pentahydroxyhexanal | present | LOTUS | |
| (2S)-2-ammonio-3-(1H-imidazol-4-yl)propanoate | present | LOTUS | |
| (2S,3S)-2-ammonio-3-methylpentanoate | present | LOTUS | |
| Arginine | present | LOTUS | |
| D-(-)-Fructose | present | LOTUS | |
| D-Alanine | present | LOTUS | |
| D-Fructose | present | LOTUS | |
| D-Glucose | present | LOTUS | |
| D-Methionine | present | LOTUS | |
| Dodecanoic acid | present | LOTUS |
05DNA & barcoding1 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus hamosus has left across the world's sequence archives.
At a glance
DNA specimens1
Marker genes4
GenBank sequences10
eDNA detections1
Countries2
The DNA barcodea real sequence read deposited for this species
TATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGTTGAGGGCACG …
Astragalus hamosus voucher PS0396MT01 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL2★ITS6★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Astragalus hamosus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidypolyploid inferred
Chromosome records14–882n range42median32mode64records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3215×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +3
CCDB · ita-fl — COLOMBO P., MARCEN C., PRINCIOTTA R. - 1983. Numeros cromosomaticos de plantas occidentales, 200-210.. Anales Jard. Bot. Madrid , 39(2): 519-524.
CCDB · ipcn-api-dl — Dalgaard, V. 1987. Chromosome Number Reports 96. Taxon 36: 660.
CCDB · ipcn-api-dl — Badr, A., M. A. Hamoud & H. A. El-Rabey. 1996. Chromosomal studies in the Egyptian flora V. Chromosomal relationships in the genus Astragalus L. (Fabaceae). Cytologia 1996: 105–111.
CCDB · ipcn-api-dl — Kuzmanov, B. & S. Georgieva. 1976. In IOPB chromosome number reports LIII. Taxon 25: 483–500.
CCDB · book-ipcn67-71 — CHUXANOVA, N.A. 1967. Chromosome numbers of some species of Leguminosae Juss. indigenous to the U.S.S.R. (In Russian). Bot. Zhur. 52: 1124-1131.
CCDB · book-ipcn75-78 — 24
CCDB · book-ipcn75-78 — Kuzmanov & Georgieva 1976
CCDB · book-ipcn73-74 — BORGEN, L. 1974. Chromosome numbers of Macaronesian flowering plants! II. Norwegian J. Bot. 21: 195-210.
CCDB · CromoCat 2015 — Borgen, L. (1974). Chromosome numbers of Macaronesian flowering plants II. Norweg. J. Bot. 21: 195-210.
CCDB · CromoCat 2015 — Chuksanova, N. A. (1967). Chromosome numbers of some species of Leguminosae Juss. indigenous to the USSR. Bot. Žurn. 52: 1124-1131.
CCDB · CromoCat 2015 — Colombo, P., Marcenó, C. & Princiotta, R. (1983a). Números cromosomáticos de plantas occidentales, 200-210. Anales Jard. Bot. Madrid 39: 519-524.
CCDB · CromoCat 2015 — Dalgaard, V. (1987). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XCVI]. Taxon 36(3): 660.
CCDB · CromoCat 2015 — Horjales, M. (1976). Contribución al estudio citotaxonómico de la flora española. Trab. Dept. Bot. Fisiol. Veg. Madrid 9: 13-18.
CCDB · CromoCat 2015 — Kuzmanov, B. & Georgieva, S. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIII]. Taxon 25(4): 500.
CCDB · CromoCat 2015 — Kuzmanov, B. (1978). Citotaxonomicno izsledvane na balgarski bobovi rastcnija. In: Evoljuclja na cvetnite rastenija i florogenez 1: 11-71.
2n 4813×CCDB · iber-fl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +2
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 249: 173-196(1975).
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · book-ipcn67-71 — FERNANDES, A., & M.F. SANTOS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal IV. Leguminosae. Bol. Soc. Brot. 45 (ser. 2): 177-226.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.
CCDB · book-atlas-flowering-plants
CCDB · CromoCat 2015 — Fernandes, A. & Santos, M. F. (1971). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae. Bol. Soc. Brot. 45: 177-226.
CCDB · CromoCat 2015 — Fernandes, A. & Santos, M. F. (1975). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Bol. Soc. Brot. 49: 173-196.
CCDB · CromoCat 2015 — Horjales, M. (1976). Contribución al estudio citotaxonómico de la flora española. Trab. Dept. Bot. Fisiol. Veg. Madrid 9: 13-18.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1974b). Cytotaxonomy of Spanish plants. IV.-Dicotyledons: Caesalpinaceae-Asteraceae. Lagascalia 4(2): 153-211.
CCDB · CromoCat 2015 — Maassoumi, A. (1987). Notes on the genus Astragalus im Iran I - cytoytaxonomic studies on some species. Iranian J. Bot. 3: 117-128.
CCDB · CromoCat 2015 — Pavlova, D. (1995). Reports (474-478). Fl. Medit. 5: 317-320.
CCDB · CromoCat 2015 — Pretel, A. & A. Sanudo. (1978). Estudios cariológicos en especies del género Astragalus L. I. Número y compartimiento de los cromosomas durante la meiosis. Lagascalia 8(1): 25-38.
2n 4412×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +1
CCDB · iber-fl — Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Luque, T. & Z. Daz Lifante.Bocconea1: 303-364(1991).
CCDB · iber-fl — IOPB. Chromosome number reports. XLVI. Pretel Martnez, A.Taxon23(5/6): 804-805(1974).
CCDB · ipcn-api-dl — Luque, T. & Z. D. Lifante. 1991. Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303–364.
CCDB · ipcn-api-dl — Díaz Lifante, Z., T. Luque & C. S. Bárbara. 1992. Chromosome numbers of plants collected during Iter Mediterraneum II in Israel. Bocconea 3: 229–250.
CCDB · ipcn-api-dl — Oberprieler, C. & R. Vogt. 1996. Chromosome numbers of North African phanerogams. VI. Some counts in Leguminosae. Willdenowia 25: 669–680.
CCDB · book-ipcn73-74 — MARTINEZ, A.P. 1974. In IOPB chromosome number reports XLVI. Taxon 23: 801-812.
CCDB · CromoCat 2015 — Horjales, M. (1976). Contribución al estudio citotaxonómico de la flora española. Trab. Dept. Bot. Fisiol. Veg. Madrid 9: 13-18.
CCDB · CromoCat 2015 — Luque, T. & Díaz Lifante, Z. (1991). Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303-364.
CCDB · CromoCat 2015 — Maassoumi, A. (1987). Notes on the genus Astragalus im Iran I - cytoytaxonomic studies on some species. Iranian J. Bot. 3: 117-128.
CCDB · CromoCat 2015 — Pavlova, D. (1995). Reports (474-478). Fl. Medit. 5: 317-320.
CCDB · CromoCat 2015 — Pretel Martínez, A. (1974). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVI]. Taxon 23(5/6): 804-805.
CCDB · CromoCat 2015 — Pretel, A. & A. Sanudo. (1978). Estudios cariológicos en especies del género Astragalus L. I. Número y compartimiento de los cromosomas durante la meiosis. Lagascalia 8(1): 25-38.
2n 427×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.
CCDB · book-ipcn75-78 — Fernandes & Queiros 1978
CCDB · CromoCat 2015 — Fernandes, A., Santos, M. F. & Queirós, M. (1977a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 51: 137-186.
CCDB · CromoCat 2015 — Horjales, M. (1976). Contribución al estudio citotaxonómico de la flora española. Trab. Dept. Bot. Fisiol. Veg. Madrid 9: 13-18.
CCDB · CromoCat 2015 — Maassoumi, A. (1987). Notes on the genus Astragalus im Iran I - cytoytaxonomic studies on some species. Iranian J. Bot. 3: 117-128.
CCDB · CromoCat 2015 — Pavlova, D. (1995). Reports (474-478). Fl. Medit. 5: 317-320.
CCDB · CromoCat 2015 — Pretel, A. & A. Sanudo. (1978). Estudios cariológicos en especies del género Astragalus L. I. Número y compartimiento de los cromosomas durante la meiosis. Lagascalia 8(1): 25-38.
2n 405×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Badr, A., M. A. Hamoud & H. A. El-Rabey. 1996. Chromosomal studies in the Egyptian flora V. Chromosomal relationships in the genus Astragalus L. (Fabaceae). Cytologia 1996: 105–111.
CCDB · CromoCat 2015 — Horjales, M. (1976). Contribución al estudio citotaxonómico de la flora española. Trab. Dept. Bot. Fisiol. Veg. Madrid 9: 13-18.
CCDB · CromoCat 2015 — Maassoumi, A. (1987). Notes on the genus Astragalus im Iran I - cytoytaxonomic studies on some species. Iranian J. Bot. 3: 117-128.
CCDB · CromoCat 2015 — Pavlova, D. (1995). Reports (474-478). Fl. Medit. 5: 317-320.
CCDB · CromoCat 2015 — Pretel, A. & A. Sanudo. (1978). Estudios cariológicos en especies del género Astragalus L. I. Número y compartimiento de los cromosomas durante la meiosis. Lagascalia 8(1): 25-38.
2n 465×CCDB · CromoCat 2015 · CCDB · iapt
CCDB · CromoCat 2015 — Horjales, M. (1976). Contribución al estudio citotaxonómico de la flora española. Trab. Dept. Bot. Fisiol. Veg. Madrid 9: 13-18.
CCDB · CromoCat 2015 — Maassoumi, A. (1987). Notes on the genus Astragalus im Iran I - cytoytaxonomic studies on some species. Iranian J. Bot. 3: 117-128.
CCDB · CromoCat 2015 — Pavlova, D. (1995). Reports (474-478). Fl. Medit. 5: 317-320.
CCDB · CromoCat 2015 — Pretel, A. & A. Sanudo. (1978). Estudios cariológicos en especies del género Astragalus L. I. Número y compartimiento de los cromosomas durante la meiosis. Lagascalia 8(1): 25-38.
CCDB · iapt — IAPT/IOPB Chromosome Data 24
2n 143×CCDB · ita-fl · CCDB · mediterranean · CCDB · CromoCat 2015
CCDB · ita-fl — DEL PRETE C., MICELI P. - 1994. Mediterranean chromosome number reports.. Flora Mediterranea , 4: 296-301.
CCDB · mediterranean
CCDB · CromoCat 2015 — Del Prete, C. & Miceli, P. (1994). Reports (387-393). Fl. Medit. 4: 296-301.
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Rani, S & KumarI,S & Gupta, R. C (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1794-1795
2n 241×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Horjales, M. (1976). Contribución al estudio citotaxonómico de la flora española. Trab. Dept. Bot. Fisiol. Veg. Madrid 9: 13-18.
2n 261×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Maassoumi, A. (1987). Notes on the genus Astragalus im Iran I - cytoytaxonomic studies on some species. Iranian J. Bot. 3: 117-128.
2n 341×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Horjales, M. (1976). Contribución al estudio citotaxonómico de la flora española. Trab. Dept. Bot. Fisiol. Veg. Madrid 9: 13-18.
2n 881×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Pavlova, D. (1995). Reports (474-478). Fl. Medit. 5: 317-320.
n 229×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +3
CCDB · iber-fl — IOPB. Chromosome number reports. XLVI. Pretel Martnez, A.Taxon23(5/6): 804-805(1974).
CCDB · ipcn-api-dl — Pretel, A. & A. Sanudo. 1978. Estudios cariologicos en especies espanolas del genero Astragalus L. I. Numero y comportamiento de los cromosomas durante la meiosis. Lagascalia 8: 25–38.
CCDB · ipcn-api-dl — HORJALES, M. 1976. Contribucion al estudio citotaxonomico de la flora espanola. Trab. Dept. Bot. Univ. Complutense 9: 13–18.
CCDB · book-ipcn72 — DELAY, J. 1971. Orophytes. Inf. Ann. Caryosyst. et Cytogenet. 5: 17-28.
CCDB · book-ipcn75-78 — 24
CCDB · book-ipcn73-74 — MARTINEZ, A.P. 1974. In IOPB chromosome number reports XLVI. Taxon 23: 801-812.
CCDB · CromoCat 2015 — Horjales, M. (1976). Contribución al estudio citotaxonómico de la flora española. Trab. Dept. Bot. Fisiol. Veg. Madrid 9: 13-18.
CCDB · CromoCat 2015 — Pretel Martínez, A. (1974). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVI]. Taxon 23(5/6): 804-805.
CCDB · CromoCat 2015 — Pretel, A. & A. Sanudo. (1978). Estudios cariológicos en especies del género Astragalus L. I. Número y compartimiento de los cromosomas durante la meiosis. Lagascalia 8(1): 25-38.
n 85×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · ipcn-api-dl — Maassoumi, A. A. 1986. Astragalus L., vol. 1, Annuals. Techn. Publ. Res. Inst. Forests Rangelands 47, Tehran.
CCDB · ipcn-api-dl — Maassoumi, A. A. 1987. Notes on the genus Astragalus in Iran I, cytotaxonomic studies on some species. Iran. J. Bot. 3: 117–128.
CCDB · CromoCat 2015 — Maassoumi, A. (1987). Notes on the genus Astragalus im Iran I - cytoytaxonomic studies on some species. Iranian J. Bot. 3: 117-128.
CCDB · CromoCat 2015 — Rani, S & KumarI,S & Gupta, R. C (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1794-1795
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type9 393 records
Wild obs. + sensor7 232
Museum / vouchered1 460
Cultivated / captive184
Other517
Origin
Native490
Introduced43
Range
Area of Occupancy AOO20 316 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy42% within 1 km
≤100 m 1 227≤1 km 998≤10 km 3 021>10 km 84
5 330 georeferenced · 1 902 without coordinates
Open the mapobservation + sensor7 232
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy52% within 1 km
≤100 m 44≤1 km 230≤10 km 240>10 km 12
526 georeferenced · 934 without coordinates
Open the institutions mapphysical evidence1 460
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 44>10 km 10
54 georeferenced · 130 without coordinates
Open the mapnot free-living184
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions38 of 74 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Berlin, DE | 215 |
| BIO-UNIPIlocation not on record | 163 |
| LDlocation not on record | 136 |
| MAlocation not on record | 101 |
| València, ES | 61 |
| Barcelona, ES | 48 |
| BClocation not on record | 47 |
| Badajoz, ES | 45 |
| CJBGlocation not on record | 40 |
| Jaén, ES | 35 |
| Granada, ES | 33 |
| Moscow State Universitylocation not on record | 33 |
| BDBClocation not on record | 31 |
| College of the Atlantic, Museumlocation not on record | 25 |
| Córdoba, ES | 25 |
| CICYTEXlocation not on record | 24 |
| Entomological Society of Latvialocation not on record | 23 |
| Adelaide, AU | 22 |
| Vitoria, ES | 22 |
| Mount Annan, AU | 22 |
| Wlocation not on record | 19 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 19 |
| BRNUlocation not on record | 16 |
| Madrid, ES | 16 |
| Paris, FR | 15 |
| Salamanca, ES | 15 |
| Phyletisches Museum Jenalocation not on record | 14 |
| Canberra, AU | 12 |
| Sevilla, ES | 11 |
| UIBlocation not on record | 11 |
| Alicante, ES | 10 |
| San Sebastián, ES | 9 |
| Pamplona, ES | 8 |
| Dresden, DE | 7 |
| Museo Entomologico de Leonlocation not on record | 6 |
| South Kensington, GB | 6 |
| Saint Louis, US | 6 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 6 |
| ISAlocation not on record | 5 |
| Bronx, US | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| AZE015location not on record | 4 |
| EEZA-CSIClocation not on record | 4 |
| Brisbane, AU | 3 |
| Oskarshamn, SE | 2 |
| Hunan Geological Museumlocation not on record | 2 |
| Coimbra, PT | 2 |
| Santiago de Compostela, ES | 2 |
| Edinburgh, GB | 2 |
| Uppsala, SE | 2 |
| Orto botanico dell'Università degli Studi di Catanialocation not on record | 2 |
| Pamplona, ES | 2 |
| Kew, GB | 1 |
| Görlitz, DE | 1 |
| ESP010location not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| Frankfurt am Main | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Provincia di Livornolocation not on record | 1 |
| Bergen, NO | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Rishon Le Zion, IL | 1 |
| Zürich, CH | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| GJOlocation not on record | 1 |
| JBSlocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Bourges, FR | 1 |
| GZUlocation not on record | 1 |
| POL003location not on record | 1 |
| Durham, US | 1 |
| Bratislava, SK | 1 |
74 institutions · 1 419 of 1 460 vouchered records shown · 40 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA1 detections
Where the DNA of Astragalus hamosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found1
Studies independent surveys1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 1 detections have coordinates
Open the map0 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.