Astragalus hallii

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records256

Data sources10

Biological traits9

DNA specimens0

eDNA detections10

Sources10 archives

Databases and archives Astragalus hallii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility256 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF256 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Astragalus hallii is a species of milkvetch in the family Fabaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition2 compounds

Compounds documented for Astragalus hallii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Indolizidine alkaloids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Swainsonine		present	LOTUS
swainsonine N-oxide		present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus hallii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

eDNA detections10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSL10777.1 ↗208 bp

ACGT

ATCGTTGCCCGATGCCTATTGCAGTTCAATAGGAATTTCTAGGGCGAATGATGGCTTCCCGTGAGCGTTGTTGCCTCGCGGTTGGTTGAA …

Astragalus hallii nuclear rRNA gene, internal transcribed spacer 2

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Astragalus hallii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 113×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ward, D. E. 1984. Chromosome counts from New Mexico and Mexico. Phytologia 56(1): 55–60.

CCDB · ipcn-api-dl — Spellenberg, R. 1981. Chromosome numbers and their cytotaxonomic significance for North American Astragalus (Fabaceae). Taxon 25: 463–472.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.996 ↗

08Occurrence & distribution

Record type256 records

Wild obs. + sensor108

Museum / vouchered148

Range

Area of Occupancy AOO788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 55≤1 km 10≤10 km 3>10 km 4

72 georeferenced · 36 without coordinates

Open the mapobservation + sensor108

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 14≤1 km 24≤10 km 49>10 km 4

91 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence148

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Colonial National Historical Parklocation not on record	58
Flagstaff, US	23
Musee des Dinosaures d'Esperaza (Aude)location not on record	22
Claremont, US	11
Albuquerque, US	4
Denver, US	3
Philadelphia, US	3
DOI/NPS, Greenbelt Parklocation not on record	3
University of Stellenboschlocation not on record	3
ASUlocation not on record	3
Phoenix, US	2
Bangkok, TH	2
Chicago, US	1
USFSlocation not on record	1
Riverside, US	1
Rocky Mountain Biological Laboratorylocation not on record	1
Chadron, US	1
AUAlocation not on record	1
Brookings, US	1
LDlocation not on record	1
Bloomington, US	1
Durango, US	1

22 institutions · 147 of 148 vouchered records shown · 1 without an institution code

09Environmental DNA10 detections

Where the DNA of Astragalus hallii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.70 °C 8.40–11.2

Seasonal swing summer↔winter40.8 °C

Max temp (day)13.3 °C 11.1–15.4

Min temp (night)6.20 °C 5.10–6.80

Precipitation38.4 mm/mo 27.6–63.1

Air humidity59.0 % 57.5–60.7

Moisture balance-60.0 mm/mo

Vapour deficit503 Pa 445–574

Wind speed4.40 m/s

Cloud cover61.0 % 50.7–70.9

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)