Astragalus gummifer

Labill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records76

Data sources13

Biological traits7

DNA specimens1

eDNA detections1

Sources13 archives

Databases and archives Astragalus gummifer's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility76 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS165 compounds

Occurrence & distributionGBIF76 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT978 Mbp

01Narrative

Astragalus gummifer (tragacanth, gum tragacanth milkvetch), is a small woody evergreen shrub, with a typical height and spread of 30 cm at maturity, indigenous to western Asia, specifically Iraq and Turkey. This nitrogen fixing plant bears hermaphroditic flowers, which are bee-pollinated. It has many medical, culinary, and material uses.“Astralagus gummifer” Practical Plants http://practicalplants.org/wiki/Astragalus_gummifer

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment4

Aquaticterrestrial

Climatetemperate

Growth formshrub

Woodinesswoody

03Chemical composition165 compounds

Compounds documented for Astragalus gummifer across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking💊 Medicinal use documented

Compound class profile5 classes

Gallotannins39

Flavones6

Ursane and Taraxastane triterpenoids5

Simple coumarins4

Piperidine alkaloids4

Documented compounds165 total

Tissue Source Quantified only

Compound	Amount	Source
BASSORIN	700,000 ppm	DukesPhytochem
TRAGACANTHIN	300,000 ppm	DukesPhytochem
CELLULOSE	40,000 ppm	DukesPhytochem
EO	30,000 ppm	DukesPhytochem
STARCH	30,000 ppm	DukesPhytochem
ASH	30,000 ppm	DukesPhytochem
ACETIC-ACID	25,000 ppm	DukesPhytochem
XENOGNOSIN	1 ppm	DukesPhytochem

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus gummifer has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences5

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP232178.1 ↗430 bpTurkey

ACGT

GGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGTTGAGGGCACGTCTGCCTGGGCG …

Astragalus gummifer voucher VLB80 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Astragalus gummifer carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size978 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Astragalus gummifer0.98 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome records16–642n range16median16mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Cartier, D. 1979. Premieres prospections caryologiques du genre Astragalus L. dans la flore du basin mediterraneen oriental. Rev. Cytol. Biol. Vég., Bot. 2: 169–181.

2n 641×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Zhu, X. y. & H. Ohashi. 2000. Systematics of Chinese Oxytropis DC. (Leguminosae). Cathaya 11–12: 1–218.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type76 records

Wild obs. + sensor68

Museum / vouchered8

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 15≤1 km 3≤10 km 2

20 georeferenced · 48 without coordinates

Open the mapobservation + sensor68

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	3
Paris, FR	2
Rishon Le Zion, IL	1
Xiamen, CN	1
BGBMlocation not on record	1

5 institutions · 8 of 8 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Astragalus gummifer was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)