Astragalus glaux

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records1 157

Data sources10

Biological traits7

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Astragalus glaux's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 157 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF1 157 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Astragalus glaux é uma espécie de planta com flor pertencente à família Fabaceae. A autoridade científica da espécie é L., tendo sido publicada em Species Plantarum 2: 759–760. 1753.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass1.81 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment2

Climatesubtropical

Growth formperennial forb

Physiology & chemistry2

Leaf dry-matter content (LDMC)244 mg/g

Specific leaf area (SLA)16.11 mm²/mg

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus glaux has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAB231111.1 ↗596 bp

ACGT

TCGATGCCTTACATGCAGACCCACTCGTGAATTTGTTTGAATACATAGGGATGGCACGGGTGTTTTGGCACCACGACCTCCCTTTGGGTA …

Astragalus glaux genes for ITS1, 5.8S rRNA, ITS2, complete sequence, specimen_voucher: Podlech 46544 (TARI)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Astragalus glaux carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode19records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1619×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +3

CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).

CCDB · iber-fl — Cromosomas dicntricos en Astragalus glaux L. Pretel Martnez, A.Ci. Biol. Ecol. Sist.6/7: 31-34(1980).

CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).

CCDB · iber-fl — IOPB. Chromosome number reports. XLVI. Pretel Martnez, A.Taxon23(5/6): 804-805(1974).

CCDB · iber-fl — Sobre los niveles de ploida y otras particularidades... Elena Rossell, J. A., M. A. Gonzlez Zapatero & F. Navarro Andrs.Stud. Bot. Univ. Salamanca4: 109-115(1987).

CCDB · ipcn-api-dl — Elena Rossello, J. A., M. A. G. Zapatero & F. N. Andres. 1985. Sobre los niveles de ploidia y otras particularidades cromosomicas de algunos vegetales Castellano-Leoneses de preferencias calcicolas. Stud. Bot. Univ. Salamanca 4: 109–115.

CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.

CCDB · book-ipcn67-71 — FERNANDES, A., & M.F. SANTOS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal IV. Leguminosae. Bol. Soc. Brot. 45 (ser. 2): 177-226.

CCDB · book-ipcn75-78 — Fernandes & Queiros 1978

CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.

CCDB · book-ipcn73-74 — MARTINEZ, A.P. 1974. In IOPB chromosome number reports XLVI. Taxon 23: 801-812.

CCDB · CromoCat 2015 — Elena Rosselló, J. A., González Zapatero, M. A. & Navarro Andrés, F. (1986). Notas cariológicas sobre algunos oroendemismos ibéricos. Lazaroa 8: 91-96.

CCDB · CromoCat 2015 — Elena Rosselló, J. A., González Zapatero, M. A. & Navarro Andrés, F. (1987c). Sobre los niveles de ploidía y otras particularidades... Stud. Bot. Univ. Salamanca 4: 109-115.

CCDB · CromoCat 2015 — Fernandes, A. & Santos, M. F. (1971). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae. Bol. Soc. Brot. 45: 177-226.

CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1974b). Cytotaxonomy of Spanish plants. IV.-Dicotyledons: Caesalpinaceae-Asteraceae. Lagascalia 4(2): 153-211.

CCDB · CromoCat 2015 — Pretel Martínez, A. (1974). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVI]. Taxon 23(5/6): 804-805.

CCDB · CromoCat 2015 — Pretel Martínez, A. (1980). Cromosomas dicéntricos en Astragalus glaux L. Ci. Biol. Ecol. Sist. 6/7: 31-34.

CCDB · CromoCat 2015 — Pretel, A. (1976). Procedimiento para facilitar el estudio de cromosomas en materiales vegetales difíciles. Cuad. Ci. Biol. 5: 53-60.

n 86×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +1

CCDB · iber-fl — IOPB. Chromosome number reports. XLVI. Pretel Martnez, A.Taxon23(5/6): 804-805(1974).

CCDB · ipcn-api-dl — Pretel, A. & A. Sanudo. 1978. Estudios cariologicos en especies espanolas del genero Astragalus L. I. Numero y comportamiento de los cromosomas durante la meiosis. Lagascalia 8: 25–38.

CCDB · book-ipcn73-74 — MARTINEZ, A.P. 1974. In IOPB chromosome number reports XLVI. Taxon 23: 801-812.

CCDB · CromoCat 2015 — Pretel Martínez, A. (1974). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVI]. Taxon 23(5/6): 804-805.

CCDB · CromoCat 2015 — Pretel, A. & A. Sanudo. (1978). Estudios cariológicos en especies del género Astragalus L. I. Número y compartimiento de los cromosomas durante la meiosis. Lagascalia 8(1): 25-38.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 157 records

Wild obs. + sensor834

Museum / vouchered322

Other1

Origin

Native144

Range

Area of Occupancy AOO2 316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 200≤1 km 187≤10 km 325>10 km 12

724 georeferenced · 110 without coordinates

Open the mapobservation + sensor834

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 14≤1 km 85≤10 km 52>10 km 1

152 georeferenced · 170 without coordinates

Open the institutions mapphysical evidence322

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MAlocation not on record	54
València, ES	27
BClocation not on record	24
Granada, ES	22
LDlocation not on record	20
Badajoz, ES	20
Salamanca, ES	17
Entomological Society of Latvialocation not on record	14
CICYTEXlocation not on record	10
Vitoria, ES	9
College of the Atlantic, Museumlocation not on record	9
Madrid, ES	9
Barcelona, ES	8
EEZA-CSIClocation not on record	6
Museo Achille Folettolocation not on record	6
Córdoba, ES	5
Jaén, ES	4
Alicante, ES	4
Museo della Bonifica di San Donà di Piavelocation not on record	4
Phyletisches Museum Jenalocation not on record	3
Wlocation not on record	3
San Jose State University, Museum of Birds and Mammalslocation not on record	3
Kew, GB	3
ISAlocation not on record	3
Bourges, FR	2
Paris, FR	2
Sevilla, ES	2
Saint Louis, US	1
BRNUlocation not on record	1
Coimbra, PT	1
Santiago de Compostela, ES	1
Pamplona, ES	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Henry Brockhouse Collectionlocation not on record	1

34 institutions · 300 of 322 vouchered records shown · 22 without an institution code

09Environmental DNA1 detections

Where the DNA of Astragalus glaux was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Astragalus glaux

At a glance

Sources10 archives

Size & morphology1

Life cycle & reproduction2

Habitat & environment2

Physiology & chemistry2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 157 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 157 records