Astragalus frigidus
(L.) A.Gray · speciesAt a glance
Occurrence records9 482
Data sources10
Biological traits34
DNA specimens15
eDNA detections9
Sources10 archives
Databases and archives Astragalus frigidus's data was compiled from.
WikipediaWikimedia Foundation10 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility9 482 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics15 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources34 traits
Occurrence & distributionGBIF9 482 records
Environmental DNA1 datasets · 2 countries9 detections
DNA & barcodingBOLD · NCBI15 specimens
Genome at a glanceCCDB2n = 16
01Narrative
Der Gletscher-Tragant (Astragalus frigidus ; Syn.: Phaca frigida ) ist eine Pflanzenart der Gattung Tragant (Astragalus) in der Familie der Hülsenfrüchtler (Fabaceae). Die Pflanze wird auch als Gletscherlinse bezeichnet.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology8
Leaf mass26.1 mg
Leaf size652 mm²
Plant height0.2 m
⚠ sources differ — GIFT: 0.2 m · LEDA: 0.2 m · TRY: 0.271 m
Plant height generative0.225 m
Plant height max0.7 m
Plant height min0.1 m
Seed length2.63 mm
Seed mass2.95 mg
Life cycle & reproduction9
Deciduousnessdeciduous
Dispersal typebythisochor
⚠ sources differ — LEDA: bythisochor · GIFT: anemochorous
Flowering endAug
Flowering startJul
Life formperennial
Life spanperennial
Lifespan years6 years
Raunkiær life formcryptophyte
Seed number18.1
Diet & foraging1
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Habitat GIFTforest, meadows, mountains, shores, shrubberies, tundra
Mycorrhiza type0.005175184
Woodinessnon-woody
Physiology & chemistry6
Leaf C:N ratio9.31 g/g
Leaf c517 mg/g
Leaf dry-matter content (LDMC)184 mg/g
Leaf n52.36 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)22.7 mm²/mg
⚠ sources differ — TRY: 22.7 mm²/mg · LEDA: 21.41 mm²/mg · GIFT: 23.47 mm²/mg
Other traits2
Diaspore typefruit
Shoot orientationerect
05DNA & barcoding15 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus frigidus has left across the world's sequence archives.
At a glance
DNA specimens15
Marker genes5
GenBank sequences6
eDNA detections9
Countries2
The DNA barcodea real sequence read deposited for this species
TCGATGCCTTACATGCAGACCAACTAGTGAATCTGTTTGAATACTTAGGGATGGCTGGGGTGTTTTGCACCACGACCTCCCTTTGGGTGG …
Astragalus frigidus genes for ITS1, 5.8S rRNA, ITS2, complete sequence, specimen_voucher: anonymous 5732 (TARI)
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL1★rbcLa★ITS4★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Astragalus frigidus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidydiploid inferred
Chromosome records16–162n range16median16mode35records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1635×CCDB · slov-fl · CCDB · iapt · CCDB · book-ipcn65 +8
CCDB · slov-fl — Murín A. & Májovský J., 1983: Karyological study of Slovakian flora IV. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 30: 1-16.
CCDB · iapt
CCDB · book-ipcn65 — Laane 1965
CCDB · ipcn-api-dl — Krasnikova, S. A., A. A. Krasnikov, T. S. Rostovtzeva & V. M. Chanminchun. 1983. Chromosome numbers of some plant species from the south of Siberia. Bot. Zhurn. SSSR 68 (6): 827–835. (In Russian).
CCDB · ipcn-api-dl — Gurzenkov, N. N. & N. S. Pavlova. 1983. Kariologicheskoe issledovanie dalnevostoch-nykh vidov Astragalus L. Tezisy Dokl. 7 Delegat. S"ezda Vsesojusn. Bot. Ob. Doneck. 17.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Gurzenkov, N. N. & N. S. Pavlova. 1984. Chromosome numbers in the representatives of the genera Astragalus and Oxytropis (Fabaceae) from the Far East of the USSR. Bot. Zhurn. SSSR 69(11): 1569–1570.
CCDB · ipcn-api-dl — Krasnikova, S. A., R. E. Krogulevich & T. S. Rostovtseva. 1984. In R.E. Krogulevich & T.S. Rostovtseva, Khromosomnye Chisla Tsvetkovykh Rastenii i Sibiri Dal'nego Vostoka. Izdatel'stvo "Nauka", Sibirskoe Otdelenie, Novosibirsk. ý.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1980. Chromosome numbers of some Southern Chukotka plant species. Bot. Zhurn. 65 (1): 51–59.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1976. Chromosome numbers of some Western Chukolka plant species, II. Bot. Žhurn. (Moscow & Leningrad) 61(7): 963–969.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1971. The role of polyploidy in the genesis of the alpine flora of the Stanovoye Nagorye Mountains. Pp. 115- 214 in The ecology of the flora of the Trans-Baikal region. Irkutsk.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Chromosome numbers of plant species from the Tunkinsky Alpes (East Sayan). News Sib. Depart. Acad. Sci. USSR, Ser. Biol. 15(3): 46–52.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. Pp. 19-48 in L. I. Malyshev & G. A. Peshlcova (eds.) Flora of the Prebaikal. Novosibirsk.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1983. Chromosome numbers of some species of the family Fabaceae from north-east Asia. Bot. Zhurn. SSSR 68 (7): 925–932.
CCDB · book-ipcn66 — Zhukova 1966
CCDB · book-ipcn67-71 — SOKOLOVSKAYA, A.P. 1968. A karyological investigation Of the flora of the Korjakian Land. (In Russian) Bot. Zurn. 53: 99-105.
CCDB · book-ipcn67-71 — MESICEK, J., & J. SOJAK. 1969. Chromosome counts of some Mongolian plants. Folia Geobot. Phytotax., Praha 4: 55-86.
CCDB · book-ipcn67-71 — KHANNA, K. R. 1967. Cytological investigation of the mosses of the Rocky Mountains. Univ. Colo. studies Ser. Biol. No. 26: 1-39.
CCDB · book-ipcn75-78 — Krogulevich 1976
CCDB · book-ipcn75-78 — Krogulevich 1971
CCDB · book-ipcn75-78 — Krogulevich 1978
CCDB · book-ipcn75-78 — Zhukova & Pe trovsky 1976
CCDB · book-northern-plants — L. & L. 1944 b.
CCDB · book-ipcn73-74 — ZHUKOVA, P.G., V.V. PETROVSKY, & T.N. PLIEVA. 1973. The chromosome numbers and taxonomy of some plant species from Siberia and Far East. (in Russian) Bot. zurn. (Moscow & Leningrad) 58: 1331-1342.
CCDB · book-indian_vol1 — Ltsve, A. & Ltsve, D. 1944b; Knaben, G. 1950 ; Ltsve, A. 1954b ; Ledin- gham, G.F. 1960 ; Sorsa, V. 1963b; Zhukova, P.G. (Fedorov) ; Mesicek, J. & Sojak, J. 1969 ; Zhukova, P.G. & Tikhonova, A.D. 1973
CCDB · book-indian_vol1 — Sokolovskaya, A.P. 1968 ; Zhukova, P.G. et al. 1973
CCDB · book-atlas-flowering-plants — L. & L. 1944b
CCDB · iapt — IAPT/IOPB Chromosome Data 19
n 81×CCDB · Cave1963
CCDB · Cave1963 — So!'sa 1963c
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type9 482 records
Wild obs. + sensor6 885
Museum / vouchered2 488
Cultivated / captive2
Other107
Origin
Introduced1
Range
Area of Occupancy AOO17 284 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy50% within 1 km
≤100 m 1 886≤1 km 1 315≤10 km 2 687>10 km 485
6 373 georeferenced · 512 without coordinates
Open the mapobservation + sensor6 885
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy37% within 1 km
≤100 m 95≤1 km 556≤10 km 729>10 km 387
1 767 georeferenced · 721 without coordinates
Open the institutions mapphysical evidence2 488
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced · 1 without coordinates
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions38 of 81 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Olocation not on record | 296 |
| Trondheim, NO | 234 |
| Moscow State Universitylocation not on record | 230 |
| Helsinki, FI | 226 |
| LDlocation not on record | 206 |
| TROMlocation not on record | 195 |
| Turku, FI | 88 |
| Uppsala, SE | 81 |
| Salzburg, AT | 80 |
| BFLlocation not on record | 69 |
| Kuopio, FI | 61 |
| Oskarshamn, SE | 58 |
| Oulu, FI | 55 |
| GJOlocation not on record | 34 |
| Irkutsk State Universitylocation not on record | 30 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 24 |
| Zürich, CH | 22 |
| Zürich, CH | 22 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 21 |
| Bern, CH | 18 |
| Jyväskylä, FI | 17 |
| BRNUlocation not on record | 17 |
| TUR-Alocation not on record | 15 |
| KMNlocation not on record | 13 |
| Urumqi, CN | 13 |
| GZUlocation not on record | 11 |
| Mlocation not on record | 11 |
| LfUlocation not on record | 10 |
| SZUlocation not on record | 10 |
| Wlocation not on record | 9 |
| SLU Artdatabankenlocation not on record | 7 |
| Institute of the biological problems of the North FEB RASlocation not on record | 7 |
| Rovaniemi, FI | 6 |
| Beijing, CN | 6 |
| University of Stellenboschlocation not on record | 5 |
| Porvoo, FI | 5 |
| Urumqi, CN | 5 |
| BClocation not on record | 5 |
| Bergen, NO | 5 |
| Porrentruy, CH | 5 |
| Glarus, CH | 5 |
| Kandalaksha State Nature Reservelocation not on record | 4 |
| Provincia di Livornolocation not on record | 4 |
| Tromso University Museumlocation not on record | 4 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 4 |
| IWEP FEB RASlocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Wellington, NZ | 2 |
| Sion, CH | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| nbflocation not on record | 2 |
| NMBU:MINAlocation not on record | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Stockholm, SE | 2 |
| Dhaka, BD | 2 |
| WTUlocation not on record | 2 |
| MAlocation not on record | 2 |
| Berlin, DE | 2 |
| Guangzhou, CN | 2 |
| Saint Louis, US | 1 |
| Dresden, DE | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Boise, US | 1 |
| Lausanne, CH | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| Karlsruhe, DE | 1 |
| CJBGlocation not on record | 1 |
| Frankfurt am Main | 1 |
| Salamanca, ES | 1 |
| Tilburg, NL | 1 |
| València, ES | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| Kew, GB | 1 |
| Görlitz, DE | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 1 |
| Uniwersytet Wrocławskilocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Xiamen, CN | 1 |
81 institutions · 2 305 of 2 488 vouchered records shown · 182 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA9 detections
Where the DNA of Astragalus frigidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found9
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 9 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.4 °C 9.00–14.5
Seasonal swing summer↔winter25.6 °C
Max temp (day)15.4 °C 11.2–17.0
Min temp (night)9.40 °C 5.20–10.9
Precipitation112 mm/mo 97.7–123
Air humidity62.0 % 60.2–64.2
Moisture balance22.1 mm/mo 14.0–27.9
Vapour deficit588 Pa 422–659
Wind speed2.60 m/s 1.90–4.70
Cloud cover61.2 % 58.5–63.7
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.