Astragalus fragrans

Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records205

Data sources7

Biological traits12

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Astragalus fragrans's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility205 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources12 traits

Occurrence & distributionGBIF205 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Astragalus fragrans is a species of milkvetch in the family Fabaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology2

Plant height max0.15 m

Plant height min0.05 m

Life cycle & reproduction4

Flowering endJun

Flowering startApr

Life formperennial or subshrub

Life spanperennial

Habitat & environment6

Climatetemperate

Elevation max3 000 m

Elevation min900 m

Growth formherb

Habitat GIFTmountains, shores, stony places

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus fragrans has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAB051967.1 ↗606 bp

ACGT

TCGATGCCTTACATGCAGACCAACTCGTGAATCTGTTTGAATACATAGGGATGGCTGGGGTGTTTGGCACCGTGGCCTCCCTTTGGGTAG …

Astragalus fragrans genes for ITS1, 5.8S rRNA, ITS2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type205 records

Wild obs. + sensor134

Museum / vouchered71

Range

Area of Occupancy AOO544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 61≤1 km 12≤10 km 4>10 km 10

87 georeferenced · 47 without coordinates

Open the mapobservation + sensor134

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 2≤1 km 4≤10 km 10

16 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence71

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	36
LDlocation not on record	13
Wlocation not on record	11
Berlin, DE	5
BClocation not on record	3
Frankfurt am Main	2
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	1

7 institutions · 71 of 71 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Astragalus fragrans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)