Astragalus didymocarpus

Hook. & Arn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records852

Data sources13

Biological traits10

DNA specimens13

eDNA detections7

Sources13 archives

Databases and archives Astragalus didymocarpus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility852 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF852 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI13 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Astragalus didymocarpus is a species of milkvetch known by the common names Dwarf white milkvetch and Two-seeded milkvetch. It is native to the southwestern United States and northern Mexico, where it can be found in many types of habitat.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual or perennial

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition2 compounds

Compounds documented for Astragalus didymocarpus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Indolizidine alkaloids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Swainsonine		present	LOTUS
swainsonine N-oxide		present	LOTUS

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus didymocarpus has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes4

GenBank sequences4

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ403841.1 ↗595 bp

ACGT

TCGATGCCTTACATGCAAACCAACTCGTGAATTTGTTTGAATACATAGGGATGGCACGGGTGTTTTGGCACCACGACCTCCCATTGGGTA …

Astragalus didymocarpus voucher ASDI-17 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Astragalus didymocarpus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidypolyploid inferred

Chromosome records24–262n range25median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — James "

2n 261×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — James 1951

n 121×CCDB · book-ipcn65

CCDB · book-ipcn65 — Raven et al. 1965

n 131×CCDB · book-ipcn65

CCDB · book-ipcn65 — Raven et al. 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type852 records

Wild obs. + sensor299

Museum / vouchered553

Origin

Native56

Range

Area of Occupancy AOO2 364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 201≤1 km 10≤10 km 7>10 km 14

232 georeferenced · 67 without coordinates

Open the mapobservation + sensor299

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 20≤1 km 132≤10 km 95>10 km 14

261 georeferenced · 292 without coordinates

Open the institutions mapphysical evidence553

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Riverside, US	87
Santa Barbara, US	72
Claremont, US	71
San Diego, US	50
ASUlocation not on record	28
San Luis Obispo, US	23
Davis, US	20
US	17
Flagstaff, US	13
Canadian Department of Agriculturelocation not on record	9
Irvine, US	7
EL PASO, US	6
Phoenix, US	6
Fredericton Stock Culture Collectionlocation not on record	6
Saint Louis, US	5
Henderson, US	4
LDlocation not on record	4
Arizona State University Biocollectionslocation not on record	4
Arcata, US	4
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	4
Angwin, US	4
Los Angeles, US	4
Bloomington, US	3
Ann Arbor, US	3
Bronx, US	2
Logan, US	2
CASlocation not on record	2
Northridge, US	2
Wuzhou, CN	2
Jena Microbial Resource Collectionlocation not on record	2
Chadron, US	1
Ensenada, MX	1
University of Stellenboschlocation not on record	1
Mexico City, MX	1
Mississippi State, US	1
Chongqing Museumlocation not on record	1
Kunming, CN	1
The University of Arizonalocation not on record	1
DOI/NPS, Greenbelt Parklocation not on record	1
San Jose, US	1
Paris, FR	1
Severin-McDaniel Insect Collectionlocation not on record	1
DOI/NPS, Colonial National Historical Parklocation not on record	1

43 institutions · 479 of 553 vouchered records shown · 74 without an institution code

09Environmental DNA7 detections

Where the DNA of Astragalus didymocarpus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

Coastal sage scrubCreosote bush scrub

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 13.2–17.1

Seasonal swing summer↔winter18.0 °C

Max temp (day)20.2 °C 19.1–24.0

Min temp (night)10.4 °C 6.40–13.3

Precipitation10.4 mm/mo 5.10–24.6

Air humidity45.5 % 44.9–59.9

Moisture balance-131 mm/mo

Vapour deficit797 Pa 699–1,037

Wind speed10.8 m/s

Cloud cover30.1 % 28.9–33.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)