Astragalus coccineus

(Parry) Brandegee · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records889

Data sources9

Biological traits13

DNA specimens4

eDNA detections2

Sources9 archives

Databases and archives Astragalus coccineus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility889 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF889 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Astragalus coccineus is a species of milkvetch known by the common name scarlet locoweed or scarlet milkvetch. It is native to the deserts, scrub, and chaparral of the Southwestern United States in Arizona, California, and Nevada, and in northwestern Mexico.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass8.42 mg

Seed mass max8.42 mg

Seed mass min8.42 mg

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus coccineus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKX678179.1 ↗552 bpCanada · 2005

ACGT

AGTGCGGGGTTCAAAGCTGGTGTTAAAGATTATAGATTGACGTATTATACTCCTGAGTATGAAACCAAAGATACTGATATCTTGGCAGCA …

Astragalus coccineus voucher HERB0264 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type889 records

Wild obs. + sensor689

Museum / vouchered200

Origin

Native46

Range

Area of Occupancy AOO1 024 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 421≤1 km 39≤10 km 34>10 km 26

520 georeferenced · 169 without coordinates

Open the mapobservation + sensor689

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 19≤1 km 49≤10 km 48>10 km 1

117 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence200

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	53
San Diego, US	26
Riverside, US	25
Bronx, US	11
Santa Barbara, US	7
Henderson, US	5
Severin-McDaniel Insect Collectionlocation not on record	5
Fullerton, US	5
Long Beach, US	4
CASlocation not on record	4
US	4
ASUlocation not on record	3
Arcata, US	3
Davis, US	3
Flagstaff, US	3
Ensenada, MX	3
San Francisco, US	2
San Luis Obispo, US	2
Arizona Western Collegelocation not on record	1
Angwin, US	1
Saint Louis, US	1
Los Angeles, US	1
Arizona State University Biocollectionslocation not on record	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Phoenix, US	1
Irvine, US	1
EL PASO, US	1
Boise, US	1
DOI/NPS, Colonial National Historical Parklocation not on record	1

29 institutions · 179 of 200 vouchered records shown · 21 without an institution code

09Environmental DNA2 detections

Where the DNA of Astragalus coccineus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Arabis pulchra, Thamnosma montana, Juniperus…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 14.5–14.5

Seasonal swing summer↔winter18.0 °C

Max temp (day)21.2 °C

Min temp (night)8.40 °C

Precipitation33.2 mm/mo

Air humidity46.5 %

Moisture balance-132 mm/mo

Vapour deficit890 Pa

Wind speed9.60 m/s

Cloud cover33.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)