Astragalus cicer
speciesAt a glance
Occurrence records17 344
Data sources15
Biological traits116
DNA specimens17
eDNA detections10
Sources15 archives
Databases and archives Astragalus cicer's data was compiled from.
WikipediaWikimedia Foundation9 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility17 344 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics17 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources116 traits
Chemical compositionLOTUS · NPASS20 compounds
Occurrence & distributionGBIF17 344 records
Environmental DNA1 datasets · 3 countries10 detections
DNA & barcodingBOLD · NCBI17 specimens
Genome at a glanceCCDB · GoaT4.1 Gbp
01Narrative
Astragalus cicer, the chickpea milkvetch, chick-pea milk-vetch or cicer milkvetch, is a perennial flowering plant native to Eastern Europe, popularized and subsequently transported to areas in Southern Europe, North America, and South America. Cicer milkvetch exhibits legume-like qualities; the plant produces pods which harbor its seeds. Its flowers are usually of pale yellow tint (sometimes white), and as such, attract bumble or European honey bees for pollination. Growth often exceeds 0.6 meters, up to a height of 1 meter in length.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology10
Leaf mass90.19 mg
Leaf size2 215 mm²
Plant height0.667 m
⚠ sources differ — GIFT: 0.667 m · LEDA: 0.425 m · USDA: 0.61 m · TRY: 0.402 m
Plant height generative0.304 m
Plant height max0.8 m
Plant height min0.05 m
Seed length2.4 mm
Seed mass3.49 mg
⚠ sources differ — TRY: 3.49 mg · LEDA: 3.92 mg · GIFT: 3.7 mg
Seed mass max4 mg
Seed mass min3.3 mg
Life cycle & reproduction34
After harvest regrowth rateModerate
Bloom periodEarly Summer
Coppice potentialNo
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscencedehiscent
Dispersal typebythisochor
Flower colourwhite
Flower conspicuousYes
Flowering endJul
Flowering startJun
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDARapid
Life formperennial
Life spanperennial
Lifespan categoryModerate
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Resprout abilityNo
Seed number58.5
Seed spread rateSlow
Seedling vigorLow
Self fertilizationabsent
Vegetative spread rateRapid
Diet & foraging1
Parasiteindependent
Habitat & environment27
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Fruit typecapsule
Growth formherb
Growth form USDARhizomatous
Habitat GIFTforest, meadows, shrubberies, steppe
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza type0.0000424
Root depth min16 in
Shape and orientationDecumbent
Small grainNo
Woodinessnon-woody
Physiology & chemistry22
Anaerobic toleranceLow
C:N ratioLow
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementLow
Fire resistantNo
Fire toleranceHigh
Frost free days min115 days
Leaf dry-matter content (LDMC)210 mg/g
Moisture useHigh
Nitrogen fixation levelHigh
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min16 in
Protein potentialHigh
Salinity toleranceMedium
Shade toleranceHigh
Soil pH max8.3 pH
Soil pH min6 pH
Specific leaf area (SLA)25.99 mm²/mg
Temperature min-43 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalHigh
Palatable graze animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound122 560 per lb
ToxicitySlight
Veneer productNo
Other traits7
Diaspore typeunknown
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max11 000 per acre
Planting density min3 450 per acre
03Chemical composition20 compounds
Compounds documented for Astragalus cicer across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols14
Cycloartane triterpenoids6
Cinnamic acids and derivatives4
Isoflavones2
Isoflavanones $ Pterocarpan2
Documented compounds20 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-Mucronulatol | present | LOTUS | |
| (1S,3R,6S,8R,11S,12S,14S,15R,16R)-14-hydroxy-7,7,12,16-tetramethyl-15-[(2R,5R)-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-6-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyheptan-2-yl]-6-[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxypentacyclo[9.7.0.01,3.03,8.012,16]octadecan-9-one | present | LOTUS | |
| (3R)-3-(6-methoxy-1,3-benzodioxol-5-yl)-3,4-dihydro-2H-chromen-7-ol | present | LOTUS | |
| 3-((3-(3,4-Dihydroxyphenyl)prop-2-enoyl)oxy)-1,4,5-trihydroxycyclohexane-1-carboxylic acid | present | LOTUS | |
| 3-(3,4-Dihydroxyphenyl)Prop-2-Enoic Acid | present | LOTUS | |
| 5-hydroxy-2-(4-hydroxyphenyl)-7-[(2R,3S,4S,5S,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one | present | LOTUS | |
| [(1S,3R,6S,8R,9S,11S,12S,14S,15R,16R)-15-[(2R,5R)-5-hydroxy-6-methyl-6-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyheptan-2-yl]-7,7,12,16-tetramethyl-6,9-bis[[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy]-14-pentacyclo[9.7.0.01,3.03,8.012,16]octadecanyl] acetate | present | LOTUS | |
| [(1S,3R,6S,8R,9S,11S,12S,14S,15R,16R)-7,7,12,16-tetramethyl-15-[(2R,5R)-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-6-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyheptan-2-yl]-6,9-bis[[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy]-14-pentacyclo[9.7.0.01,3.03,8.012,16]octadecanyl] acetate | present | LOTUS | |
| Acicerone | present | LOTUS | |
| Astragalin | present | NPASS |
05DNA & barcoding17 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus cicer has left across the world's sequence archives.
At a glance
DNA specimens17
Marker genes5
GenBank sequences10
eDNA detections10
Countries3
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGTTGAGGGCACGTCTGCCTGGGCGTCACATATC …
Astragalus cicer voucher CCDB-18330-B1 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL5★rbcLa★ITS3★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Astragalus cicer carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size4 078 260 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Astragalus cicer4.08 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 64 n = 32
Ploidy8× octoploid · measured
Chromosome records16–642n range64median64mode26records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 6421×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · nw-europe-fl +7
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2862
CCDB · poland — Pogan E., Izmai?ow R. et al. 1983. Further studies in chromosome numbers of Polish Angiosperms. Part XVII. Acta Biol. Cracov. Ser. Bot. 25, 57-77.
CCDB · ipcn-api-dl — Pogan, E. 1983. Further studies in chromosome numbers of Polish angiosperms. Part XVII. Acta Biol. Cracov., Ser. Bot. 25: 57–77.
CCDB · ipcn-api-dl — Buttler, K. P. 1985. Chromosomenzahlen von Gefässpflanzen aus Hessen (und angrenzenden Ländern), 3. Folge. Hess. Florist. Briefe 34: 37–42.
CCDB · ipcn-api-dl — Semerenko, L. V. & I. V. Shvets. 1989. Karyologicheskoe isuchenie bobovykh (Fabaceae) Belorussii. Pp. 66--68 in Tesizy II Symp. Plant Karyology.
CCDB · ipcn-api-dl — Zhu, X. y. & H. Ohashi. 2000. Systematics of Chinese Oxytropis DC. (Leguminosae). Cathaya 11–12: 1–218.
CCDB · ipcn-api-dl — Magulaev, A. J. 1980. Chromosome numbers of some Fabaceae in the North Caucasus. Bot. Zhurn. 65 (6): 836–843.
CCDB · book-atlas-flowering-plants
CCDB · kew — Münzbergová Z. 2009. The effect of genome size on detailed species traits within closely related species of the same hábitat. Botanical Journal of the Linnean Society 160: 290-298.
CCDB · Cave1963 — Led. & Rever 1963
CCDB · Cave1963 — Led. & Rever 19f.3
CCDB · CromoCat 2015 — Dvorák, F., Dadáková, B. & Grüll, F. (1977). Studies of the morphology of chromosomes of some selected species. Folia Geobot. Phytotax. (Bohem.) 12: 343-375.
CCDB · CromoCat 2015 — Latterell, R. L. & Townsend, C. E. (1993). Meiotic analysis of Astragalus cicer L. I. Octoploids International Journal of Plant Sciences 154: 450-457
CCDB · iapt — IAPT/IOPB Chromosome Data 26
2n 322×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Latterell, R. L. & C. E. Townsend. 1994. Meiotic analysis of Astragalus cicer L. II. Polyhaploids. Int. J. Pl. Sci. 155: 475–480.
CCDB · CromoCat 2015 — Latterell, R. L. & Townsend, C. E. (1994). Meiotic analysis of Astragalus cicer L. II. Polyhaploids International Journal of Plant Sciences 155: 475-480
2n 482×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Pavlova, D. K. & S. I. Kozhuharov. 1993. Chromosome numbers of Bulgarian angiosperms. Fitologija 44: 75.
CCDB · CromoCat 2015 — Pavlova, D. (1988). Taxonomicno izucavane na predstaviteli ot roda Astragalus L. (klin) v Balgarija. 186 p. Dissertation Univ. Sofia
2n 161×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — KOZUHAROV, S., A. Petrova & T. MARKOVA. 1975a. Cytotaxonomic study of Bulgarian Leguminosae species. I. Pp. 31-47 in Bulg. Acad. Sci., In Honour of Acad. D. Jordanov.
2n 651×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Latterell, R. L. & Townsend, C. E. (1993). Meiotic analysis of Astragalus cicer L. I. Octoploids International Journal of Plant Sciences 154: 450-457
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
octoploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type17 344 records
Wild obs. + sensor14 924
Museum / vouchered2 370
Cultivated / captive4
Other46
Origin
Native27
Introduced43
Range
Area of Occupancy AOO33 284 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy60% within 1 km
≤100 m 5 282≤1 km 996≤10 km 3 927>10 km 335
10 540 georeferenced · 4 384 without coordinates
Open the mapobservation + sensor14 924
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy45% within 1 km
≤100 m 104≤1 km 402≤10 km 560>10 km 61
1 127 georeferenced · 1 243 without coordinates
Open the institutions mapphysical evidence2 370
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 2>10 km 1
3 georeferenced · 1 without coordinates
Open the mapnot free-living4
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions78 of 163 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 349 |
| BFLlocation not on record | 246 |
| BRNUlocation not on record | 183 |
| Uniwersytet Wrocławskilocation not on record | 158 |
| LDlocation not on record | 74 |
| Zürich, CH | 74 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 57 |
| GZUlocation not on record | 56 |
| Zürich, CH | 39 |
| Bern, CH | 37 |
| BIO-UNIPIlocation not on record | 33 |
| CJBGlocation not on record | 33 |
| No collectionlocation not on record | 30 |
| Bronx, US | 30 |
| Voronezh State Universitylocation not on record | 24 |
| Oskarshamn, SE | 23 |
| LfUlocation not on record | 23 |
| Salzburg, AT | 22 |
| Uppsala, SE | 22 |
| GJOlocation not on record | 21 |
| Bozeman, US | 20 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 20 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 20 |
| Lausanne, CH | 19 |
| Denver, US | 18 |
| Wlocation not on record | 17 |
| Turku, FI | 17 |
| Provincia di Livornolocation not on record | 16 |
| Adam Mickiewicz University in Poznańlocation not on record | 15 |
| Uniwersytet Warszawskilocation not on record | 15 |
| Tartu, EE | 15 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 15 |
| Vancouver, CA | 14 |
| Tula State Universitylocation not on record | 14 |
| Mlocation not on record | 13 |
| Pullman, US | 13 |
| Helsinki, FI | 13 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 13 |
| Dresden, DE | 12 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 12 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 11 |
| Wuzhou, CN | 11 |
| Görlitz, DE | 11 |
| ASUlocation not on record | 10 |
| Flagstaff, US | 10 |
| Chadron, US | 10 |
| WTUlocation not on record | 9 |
| Missoula, US | 9 |
| Claremont, US | 9 |
| Berlin, DE | 9 |
| Logan, US | 8 |
| CZE096location not on record | 8 |
| SLU Artdatabankenlocation not on record | 8 |
| Whitehorse, CA | 8 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 8 |
| St. Paul, US | 7 |
| Science Museum of Minnesotalocation not on record | 7 |
| Boise, US | 7 |
| Provo, US | 6 |
| John May Museum of Natural Historylocation not on record | 6 |
| Victoria, CA | 6 |
| PRClocation not on record | 6 |
| Canadian Department of Agriculturelocation not on record | 5 |
| University of Stellenboschlocation not on record | 5 |
| Corvallis, US | 5 |
| Davis, US | 5 |
| Tempe, US | 4 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 4 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 4 |
| Durango, US | 4 |
| University of Alberta Museumslocation not on record | 4 |
| South Kensington, GB | 4 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| DOI/NPS, Greenbelt Parklocation not on record | 4 |
| Riverside, US | 4 |
| Sion, CH | 4 |
| Chongqing Museumlocation not on record | 4 |
| Philadelphia, US | 4 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Trondheim, NO | 3 |
| Université Lavallocation not on record | 3 |
| Rocky Mountain Biological Laboratorylocation not on record | 3 |
| Ann Arbor, US | 3 |
| Québec, CA | 3 |
| Yukon Universitylocation not on record | 3 |
| CASlocation not on record | 3 |
| PrivatHerblocation not on record | 3 |
| Research Collection of B. A. Bennettlocation not on record | 3 |
| Karlsruhe, DE | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Frankfurt am Main | 3 |
| Dhaka, BD | 3 |
| Brookings, US | 3 |
| IDElocation not on record | 3 |
| H-Adlerlocation not on record | 3 |
| Jena Microbial Resource Collectionlocation not on record | 3 |
| Moscow, US | 3 |
| Lincoln, US | 2 |
| Brussel, BE | 2 |
| FLADlocation not on record | 2 |
| Austin, US | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Dekalb, US | 2 |
| MeiseBGlocation not on record | 2 |
| Albuquerque, US | 2 |
| ROM007location not on record | 2 |
| H-Schuhwlocation not on record | 2 |
| Macomb, US | 2 |
| Kuopio, FI | 2 |
| Anchorage, US | 2 |
| Orem, US | 2 |
| USFS/BHSClocation not on record | 2 |
| US | 2 |
| University of Bayreuthlocation not on record | 2 |
| BClocation not on record | 2 |
| Saint Louis, US | 2 |
| SZUlocation not on record | 2 |
| Samara National Research Universitylocation not on record | 1 |
| Acadia Universitylocation not on record | 1 |
| H-Dueringlocation not on record | 1 |
| Bergen, NO | 1 |
| ARM059location not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Jyväskylä, FI | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Montréal, CA | 1 |
| San Luis Obispo, US | 1 |
| Burlington, US | 1 |
| Bourges, FR | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Porrentruy, CH | 1 |
| Cambridge, US | 1 |
| Fort Worth, US | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Institute of Botany, Ilia State Universitylocation not on record | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| DULlocation not on record | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| Henderson, US | 1 |
| Caldwell, US | 1 |
| Toronto, CA | 1 |
| McWane Science Centerlocation not on record | 1 |
| CJBNlocation not on record | 1 |
| Paris, FR | 1 |
| SVK001location not on record | 1 |
| CONCOLlocation not on record | 1 |
| San Diego, US | 1 |
| San Angelo, US | 1 |
| GBR016location not on record | 1 |
| AZE015location not on record | 1 |
| MAlocation not on record | 1 |
| Grand Junction, US | 1 |
| Bloomington, US | 1 |
| Madison, US | 1 |
| Tampa, US | 1 |
| Olocation not on record | 1 |
| TUR-Alocation not on record | 1 |
| Fulda, DE | 1 |
| Fribourg, CH | 1 |
| Tilburg, NL | 1 |
163 institutions · 2 248 of 2 370 vouchered records shown · 106 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA10 detections
Where the DNA of Astragalus cicer was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.4 °C 9.00–17.3
Seasonal swing summer↔winter24.1 °C
Max temp (day)17.0 °C 13.3–23.1
Min temp (night)10.1 °C 2.50–13.4
Precipitation81.2 mm/mo 49.7–103
Air humidity59.7 % 55.2–62.7
Moisture balance-13.8 mm/mo -57.0–33.4
Vapour deficit706 Pa 429–839
Wind speed3.00 m/s 1.80–4.60
Cloud cover42.3 % 35.5–46.8
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.