Astragalus cibarius

E.Sheld. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records1 425

Data sources12

Biological traits14

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Astragalus cibarius's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 425 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS · NPASS29 compounds

Occurrence & distributionGBIF1 425 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Astragalus cibarius, commonly called the browse milkvetch, is a species of plant in the legume family. It is native to western North America, in the U.S. states of Colorado, Idaho, Montana, Nevada, Utah, and Wyoming. It is a widespread and common species, found in valley floors, plains, and foothills. It is particularly associated with sagebrush, which it often grows under. It is a perennial that produces pink-purple and white colored flowers in the spring.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass5.74 mg

Seed mass max5.94 mg

Seed mass min5.6 mg

Life cycle & reproduction3

Deciduousnessdeciduous

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition29 compounds

Compounds documented for Astragalus cibarius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Monomeric stilbenes7

Flavonols6

Dicarboxylic acids3

Simple coumarins2

Proanthocyanins2

Documented compounds29 total

Tissue Source Quantified only

Compound	Amount	Source
(E)-Resveratrol 3-(6''-Galloyl)-O-Beta-D-Glucopyranoside	present	NPASS
(E)-Resveratrol 3-glucoside	present	NPASS
1,2,6-Tris-O-(3-nitropropanoyl)hexopyranose	present	LOTUS
2-Butenedioic acid	present	LOTUS
2H-1-Benzopyran-2-one, 5,7-dihydroxy-	present	NPASS
3,3',4'5-Tetrahydroxystilbene	present	NPASS
5,7-dihydroxy-2-(3-hydroxy-4-methoxyphenyl)-3-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	LOTUS
8-[3-[(Z)-Oct-2-Enyl]Oxiran-2-Yl]Octanoic Acid	present	NPASS
[(2R,3R)-8-[(2R,3S,4S)-2-(3,4-dihydroxyphenyl)-3,5,7-trihydroxy-3,4-dihydro-2H-chromen-4-yl]-5,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-3-yl] 3,4,5-trihydroxybenzoate	present	NPASS
[(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-[3-hydroxy-5-[(E)-2-(4-hydroxyphenyl)ethenyl]phenoxy]oxan-2-yl]methyl 4-hydroxy-3,5-dimethoxybenzoate	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus cibarius has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF121729.1 ↗597 bp

ACGT

TCGATGCCTTACATGCAGACCAACTCGTGAATTTGTTTGAATACATAGGGATGGCACGGGTGTTTTGGCACCACGACCTCCCTTTGGGTA …

Astragalus cibarius internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Astragalus cibarius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · Cave1957

CCDB · Cave1957 — Head

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 425 records

Wild obs. + sensor796

Museum / vouchered629

Origin

Native1

Range

Area of Occupancy AOO2 948 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 455≤1 km 75≤10 km 20>10 km 27

577 georeferenced · 219 without coordinates

Open the mapobservation + sensor796

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 47≤1 km 66≤10 km 96>10 km 5

214 georeferenced · 415 without coordinates

Open the institutions mapphysical evidence629

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	138
Provo, US	76
US	56
Moscow, US	44
Claremont, US	38
Pocatello, US	37
Boise, US	26
Missoula, US	26
Pittsburg, US	23
Bozeman, US	22
Pullman, US	19
DOI/NPS, Colonial National Historical Parklocation not on record	16
Logan, US	14
Orem, US	14
WTUlocation not on record	8
Henderson, US	7
Musee des Dinosaures d'Esperaza (Aude)location not on record	6
Jena Microbial Resource Collectionlocation not on record	6
Caldwell, US	5
ASUlocation not on record	5
Chongqing Museumlocation not on record	4
Flagstaff, US	4
DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record	4
Riverside, US	3
Columbia, US	3
Corvallis, US	3
San Luis Obispo, US	3
Wuzhou, CN	2
Chadron, US	2
Weber State Universitylocation not on record	2
LDlocation not on record	2
Bureau of Land Managementlocation not on record	1
DOI/NPS, Greenbelt Parklocation not on record	1
Durango, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Kew, GB	1
CASlocation not on record	1
Xiamen, CN	1
Phoenix, US	1
Bangkok, TH	1
BOISlocation not on record	1
Wlocation not on record	1

42 institutions · 629 of 629 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Astragalus cibarius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Astragalus cibarius

At a glance

Sources12 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

Compound class profile5 classes

Documented compounds29 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 425 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions27 of 42 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 425 records