Astragalus casei — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records410

Data sources7

Biological traits9

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Astragalus casei's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility410 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF410 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Astragalus casei is a species of milkvetch known by the common name Case's milkvetch. It is native to the Mojave Desert and its sky island woodlands of eastern California and western Nevada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus casei has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKEU025878.1 ↗1 521 bp

ACGT

ATGAAGGAATATCAAGTATTTTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTAGGGAGTATGTTTATGGA …

Astragalus casei maturase-like protein (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1

plant barcode

08Occurrence & distribution

Record type410 records

Wild obs. + sensor163

Museum / vouchered247

Origin

Native2

Range

Area of Occupancy AOO888 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 103≤1 km 9≤10 km 7>10 km 6

125 georeferenced · 38 without coordinates

Open the mapobservation + sensor163

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 5≤1 km 37≤10 km 22>10 km 1

65 georeferenced · 182 without coordinates

Open the institutions mapphysical evidence247

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions28 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	61
Claremont, US	50
Riverside, US	21
Henderson, US	15
Santa Barbara, US	11
Davis, US	11
ASUlocation not on record	8
CASlocation not on record	6
San Diego, US	5
Orem, US	3
Flagstaff, US	3
Boise, US	3
Phoenix, US	3
Logan, US	2
Arcata, US	2
Saint Louis, US	2
Moscow, US	2
Caldwell, US	2
Fullerton, US	2
US	1
US	1
San Francisco, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
San Jose, US	1
GB	1
San Luis Obispo, US	1
Canadian Department of Agriculturelocation not on record	1
Long Beach, US	1
LDlocation not on record	1
Wuzhou, CN	1
Bozeman, US	1
Angwin, US	1
Los Angeles, US	1

33 institutions · 226 of 247 vouchered records shown · 21 without an institution code

09Environmental DNA1 detections

Where the DNA of Astragalus casei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.