Astragalus bolanderi

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records342

Data sources8

Biological traits9

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Astragalus bolanderi's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility342 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF342 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Astragalus bolanderi is a species of milkvetch known by the common name Bolander's milkvetch. It is native to western Nevada and parts of the Sierra Nevada in California. It grows in dry, rocky habitat on mountain and plateau.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus bolanderi has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ439256.1 ↗6 467 bpUSA · 2010

ACGT

CTTGGCGCAATGTGGTGTGGTTGCCTTCGGATGTCATGCTTAGCGGCGCGGAGAAGGCTCCATCGGATTACTCCATATCCTTACTATGCC …

Astragalus bolanderi isolate GKH 16809 5' external transcribed spacer, partial sequence; 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence; and 3' external transcribed spacer, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Astragalus bolanderi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 111×CCDB · Cave1959

CCDB · Cave1959 — Snow 1959

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type342 records

Wild obs. + sensor168

Museum / vouchered174

Range

Area of Occupancy AOO700 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 95≤1 km 11≤10 km 8>10 km 4

118 georeferenced · 50 without coordinates

Open the mapobservation + sensor168

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 7≤1 km 64≤10 km 29>10 km 4

104 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence174

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	18
Santa Barbara, US	17
Riverside, US	14
Davis, US	10
San Diego, US	8
CASlocation not on record	8
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	8
Fredericton Stock Culture Collectionlocation not on record	6
Bronx, US	5
Angwin, US	4
San Luis Obispo, US	3
US	3
St. Paul, US	3
Canadian Department of Agriculturelocation not on record	2
San Jose, US	2
San Francisco, US	2
Severin-McDaniel Insect Collectionlocation not on record	2
Provo, US	1
EL PASO, US	1
Long Beach, US	1
DOI/NPS, Greenbelt Parklocation not on record	1
Columbia, US	1
Los Angeles, US	1
US	1

24 institutions · 122 of 174 vouchered records shown · 52 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)