Astragalus bibullatus — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records102

Data sources6

Biological traits9

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Astragalus bibullatus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility102 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF102 records

DNA & barcodingNCBIsequences

01Narrative

Pyne's ground plum (fruits) Close-up of the flowers Astragalus bibullatus, the limestone glade milkvetch or Pyne's ground plum, is an endangered species of flowering plant that is endemic to the cedar glades of the central basin of Tennessee in the United States. It is found in only eight populations located within a few kilometers of each other in Rutherford County, Tennessee.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus bibullatus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSMK355968.1 ↗542 bp

ACGT

TCGATGCCTTACATGCAGACCAACTCGTGAATTTGTTTGAATACATAGGGATGGCACGAGTGTTTTGGCACCACGGCCTCCCTTTGGGTA …

Astragalus bibullatus voucher Pyne & Evans s.n. 1994, TENN internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type102 records

Wild obs. + sensor94

Museum / vouchered8

Origin

Native5

Range

Area of Occupancy AOO332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy3% within 1 km

≤1 km 3≤10 km 2>10 km 89

94 georeferenced

Open the mapobservation + sensor94

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	6
Denver, US	1
Saint Louis, US	1

3 institutions · 8 of 8 vouchered records shown