Astragalus balearicus

Chater · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Astragalus

At a glance

Occurrence records414

Data sources7

Biological traits5

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Astragalus balearicus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility414 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources5 traits

Occurrence & distributionGBIF414 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

Astragalus balearicus, commonly known as the Balearic milkvetch or gatovell, is a small legume of the genus Astragalus that is found on the Balearic Islands off the coast of Spain.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formsubshrub

Raunkiær life formchamaephyte

Habitat & environment3

Climatesubtropical

Growth form detailedsubshrub

Woodinesswoody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus balearicus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKR816923.1 ↗204 bpSpain

ACGT

TCGTGAATCTGTTTGAATACATAGGGATGGCTGGGGTGTTTGGCACCTTGGCCTCCCTTTGGGTAGGAAGGGGTGCGCGCGCGTTCCCCT …

Astragalus balearicus isolate Abalea1 internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Astragalus balearicus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 164×CCDB · iber-fl · CCDB · CromoCat 2015

CCDB · iber-fl — Contribuci a l'estudi citotaxonmic de la flora de les Balears. II Cardona, M. A.Colloquis Soc. Catal. Biol. Genet.10-11: 51-67(1977).

CCDB · CromoCat 2015 — Cardona, M. À. (1978a). Contribució a l'estudi citotaxonòmic de la flora de les Balears. II. Colloq. Soc. Catalana Biol. 10-11: 51-67.

CCDB · CromoCat 2015 — Castro, M. & Rosselló, J. A. (2006a). Chromosome numbers in plant taxa endemic to the Balearic Islands Folia Geobotanica 41: 433-451

CCDB · CromoCat 2015 — Contandriopoulos, J. & Cardona, M. À. (1984). Caractère original de la flore endémique des Baléares. Bot. Helv. 94(1): 101-132.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type414 records

Wild obs. + sensor325

Museum / vouchered87

Other2

Range

Area of Occupancy AOO524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 115≤1 km 59≤10 km 53>10 km 7

234 georeferenced · 91 without coordinates

Open the mapobservation + sensor325

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 4≤1 km 33≤10 km 19>10 km 1

57 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence87

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UIBlocation not on record	17
Barcelona, ES	14
JBSlocation not on record	11
LDlocation not on record	9
MAlocation not on record	8
College of the Atlantic, Museumlocation not on record	8
BClocation not on record	3
Madrid, ES	2
Alicante, ES	2
Salamanca, ES	2
Entomological Society of Latvialocation not on record	2
València, ES	2
Badajoz, ES	2
San Sebastián, ES	1
Dresden, DE	1
John May Museum of Natural Historylocation not on record	1
Wlocation not on record	1
Uppsala, SE	1

18 institutions · 87 of 87 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)