Astragalus alpinus
speciesAt a glance
Occurrence records28 513
Data sources14
Biological traits38
DNA specimens119
eDNA detections53
Sources14 archives
Databases and archives Astragalus alpinus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility28 513 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI53 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics119 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources38 traits
Chemical compositionLOTUS · NPASS8 compounds
Occurrence & distributionGBIF28 513 records
Environmental DNA1 datasets · 6 countries53 detections
DNA & barcodingBOLD · NCBI119 specimens
Genome at a glanceCCDB · GoaT · NCBI939 Mbp
01Narrative
Astragalus alpinus, l'Astragale des Alpes, est une espèce de plantes à fleurs de la famille des Fabaceae. C'est une plante herbacée de l'hémisphère nord.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass4.1 mg
Leaf size231 mm²
⚠ sources differ — TRY: 231 mm² · LEDA: 162 mm² · GIFT: 162 mm²
Plant height0.117 m
⚠ sources differ — GIFT: 0.117 m · LEDA: 0.109 m · TRY: 0.07 m
Plant height generative0.035 m
Plant height max0.3 m
Plant height min0.04 m
Seed length2.25 mm
Seed mass2.07 mg
Seed mass max2.32 mg
Seed mass min1.97 mg
Life cycle & reproduction9
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typebythisochor
⚠ sources differ — LEDA: bythisochor · GIFT: anemochorous
Flowering endAug
Flowering startJun
Life formperennial or subshrub
Life spanperennial
Lifespan years9 years
Raunkiær life formhemicryptophyte
Seed number58
Diet & foraging1
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatesubalpine or subarctic
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Habitat GIFTforest, meadows, mountains, rivers, sand, shrubberies, tundra
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio12.45 g/g
Leaf c463 mg/g
Leaf dry-matter content (LDMC)232 mg/g
⚠ sources differ — TRY: 232 mg/g · LEDA: 183 mg/g
Leaf n46.61 mg/g
Leaf p2.98 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)23.01 mm²/mg
Other traits2
Diaspore typefruit
Shoot orientationascending
03Chemical composition8 compounds
Compounds documented for Astragalus alpinus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Labdane diterpenoids2
Caryophyllane sesquiterpenoids2
Miscellaneous meroterpenoids1
Simple coumarins1
Hydrocarbons1
Documented compounds8 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-Caryophyllene | present | NPASS | |
| (1R,2R,4aR,8aR)-1-[2-(furan-3-yl)ethyl]-1,4a,5-trimethyl-2,3,4,7,8,8a-hexahydronaphthalene-2-carbaldehyde | present | NPASS | |
| (1R,4aS,8aS)-5,5,8a-trimethyl-1-[2-(5-oxo-2H-furan-3-yl)ethyl]-1,4,4a,6,7,8-hexahydronaphthalene-2-carbaldehyde | present | NPASS | |
| (1R,4S,6R,10S)-4,12,12-trimethyl-9-methylidene-5-oxatricyclo[8.2.0.04,6]dodecane | present | NPASS | |
| 3-[2-[(1R,4aS,8aS)-2-(hydroxymethyl)-5,5,8a-trimethyl-1,4,4a,6,7,8-hexahydronaphthalen-1-yl]ethyl]-2H-furan-5-one | present | NPASS | |
| 3-[4-Hydroxy-2,6-bis(3-methylbut-2-enyl)phenyl]prop-2-enoic acid | present | NPASS | |
| Nonancosane | present | LOTUS | |
| Umbelliferone | present | NPASS |
05DNA & barcoding119 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astragalus alpinus has left across the world's sequence archives.
At a glance
DNA specimens119
Marker genes8
GenBank sequences10
eDNA detections53
Countries6
The DNA barcodea real sequence read deposited for this species
GGCAGCATTCCGAGTAACTCCTCAACCTGGGGTTCCTCCTGAAGAAGCTGGTGCTGCGGTAGCTGCCGAATCTTCCACTGGGACATGGAC …
Astragalus alpinus voucher YNP_HA266 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK6★rbcL4★rbcLa★trnL-F★ITS★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Astragalus alpinus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size938 880 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Astragalus alpinus0.94 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records16–322n range16median16mode57records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1636×CCDB · ita-fl · CCDB · slov-fl · CCDB · iber-fl +8
CCDB · ita-fl — FAVARGER C. - 1965. Notes de caryologie alpine. IV.. Bull. Soc. Neuchateloise Sci. Nat. , 88: 60.
CCDB · slov-fl — Kochjarová J., 1991: Karyological study of the Slovak flora XXIII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 38 [1990]: 89-99.
CCDB · slov-fl — Murín A., 1992: Karyological study of the Slovak flora XXIV. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 39: 45-51.
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · slov-fl — Májovský J., Uhríková A. & Dúbravcová Z., 1996: Karyotaxonomic analysis of supramontane populations of species of the genus Astragalus in Slovakia. - Oecologia Montana 5/2: 87-92.
CCDB · iber-fl — Recherches sur les liens de parent entre la flore orophile des Alpes et celledes Pyrnes. Kpfer, P.Boissiera23: 3-322(1974).
CCDB · book-ipcn65 — Favarger 1965a; Laane 1965
CCDB · ipcn-api-dl — Gurzenkov, N. N. & N. S. Pavlova. 1983. Kariologicheskoe issledovanie dalnevostoch-nykh vidov Astragalus L. Tezisy Dokl. 7 Delegat. S"ezda Vsesojusn. Bot. Ob. Doneck. 17.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Gurzenkov, N. N. & N. S. Pavlova. 1984. Chromosome numbers in the representatives of the genera Astragalus and Oxytropis (Fabaceae) from the Far East of the USSR. Bot. Zhurn. SSSR 69(11): 1569–1570.
CCDB · ipcn-api-dl — Murín, A. 1992. Karyological study of the Slovak flora XXIV. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 39: 45–51.
CCDB · ipcn-api-dl — Belaeva, V. A. & V. N. SIPLIVINSKY. 1976. Chromosome numbers and taxonomy of some species of Baikal flora. Bot. Žhurn. (Moscow & Leningrad) 61(6): 873–880.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1977. Chromosome numbers of some plant species from the south of Siberia. II. Bot. Žhurn. (Moscow & Leningrad) 62(7): 1034–1042.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Chromosome numbers of plant species from the Tunkinsky Alpes (East Sayan). News Sib. Depart. Acad. Sci. USSR, Ser. Biol. 15(3): 46–52.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. Pp. 19-48 in L. I. Malyshev & G. A. Peshlcova (eds.) Flora of the Prebaikal. Novosibirsk.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1984. In R.E. Krogulevich & T.S. Rostovtseva, Khromosomnye Chisla Tsvetkovykh Rastenii i Sibiri Dal'nego Vostoka. Izdatel'stvo "Nauka", Sibirskoe Otdelenie, Novosibirsk. ý.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1990. Chromosome numbers in some species of flowering plants of the Urals (the Komi Autonomous Soviet Socialist Republic). Bot. Žhurn. (Moscow & Leningrad) 75: 1622–1624.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1983. Chromosome numbers of some species of the family Fabaceae from north-east Asia. Bot. Zhurn. SSSR 68 (7): 925–932.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1976. Chromosome numbers of some Western Chukolka plant species, II. Bot. Žhurn. (Moscow & Leningrad) 61(7): 963–969.
CCDB · book-ipcn67-71 — FAVARGER, C., & P. KUPFER. 1968. Contribution a la cytotaxinomie de la flore alpine des Pyrenees. Collect. Bot. 7: 325-352.
CCDB · book-ipcn67-71 — KHANNA, K. R. 1967. Cytological investigation of the mosses of the Rocky Mountains. Univ. Colo. studies Ser. Biol. No. 26: 1-39.
CCDB · book-ipcn75-78 — Krogulevich 1978
CCDB · book-ipcn75-78 — Rostovtseva 1977
CCDB · book-ipcn75-78 — Krogulevich 1976
CCDB · book-ipcn75-78 — Belaeva & Siplivinsky 1976
CCDB · book-ipcn75-78 — Zhukova & Petrovsky 1976
CCDB · book-ipcn73-74 — KUPFER, P. 1974. Recherches sur les liens de parente entre la flore orophile des Alpes et celle des Pyrenees. Boissiera 23: 1-322.
CCDB · book-indian_vol1 — Favarger, C. 1949b, 1965 ; Sorsa, V. 1963b ; Hedberg, I. & Hedberg, 0~ 1964 ; Hedberg, O. 1967 ; Favarger, C. & Kupfer, P. 1968; Laine, U. et al. 1974
CCDB · book-indian_vol1 — Spellenberg, R. 1976
CCDB · iapt — IAPT/IOPB Chromosome Data 17
CCDB · CromoCat 2015 — Favarger, C. & Küpfer, P. (1968). Contribution à la cytotaxonomie de la flore alpine des Pyréneés. Collect. Bot. (Barcelona) 7(1): 325-357.
CCDB · CromoCat 2015 — Küpfer, P. (1974). Recherches sur les liens de parenté entre la flore orophile des Alpes et celle des Pyrénées. Boissiera 23: 3- 322.
2n 3220×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71 +6
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Pavlova, N. S., N. S. Probatova & A. P. Sokolovskaja. 1989. Taksonomicheskij obzor semejstva Fabaceae, chisla khromosom i rasprostranenie na Sovetskom Dal'nem Vostoke. Komarovskie Čtenija (Vladivostok) 36: 20–47.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1983. Chromosome numbers of some species of the family Fabaceae from north-east Asia. Bot. Zhurn. SSSR 68 (7): 925–932.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Yurtsev, B. A. & P. G. ZHUKOVA. 1982. Chromosome numbers of some plants of the northeastern Yakutia (the drainage of the Indigirka River in its middle reaches). Bot. Zhurn. 67 (6): 778–787. (In Russian).
CCDB · book-ipcn66 — Mosquin & Hayley 1966
CCDB · book-ipcn66 — Zhukova 1966
CCDB · book-ipcn67-71 — JOHNSON, A.W., & J.G. PACKER. 1968. Chromosome numbers in the flora of Ogotruk Creek, N.W. Alaska. Bot. Not. 121: 403-456.
CCDB · book-ipcn67-71 — SOKOLOVSKAYA, A.P. 1968. A karyological investigation Of the flora of the Korjakian Land. (In Russian) Bot. Zurn. 53: 99-105.
CCDB · book-ipcn67-71 — MULLIGAN, G.A., & A.E. PORSILD. 1969. Chromosome numbers of some plants from the unglaciated central Yukon plateau, Canada. Canad. J. Bot. 47: 655-662.
CCDB · book-ipcn67-71 — HEDBERG, o. 1967. Chromosome numbers of vascular plants from arctic and subarctic North America. Ark. f. Bot. Ser. 2. 6: 309-326.
CCDB · book-ipcn75-78 — Zhukova et al. 1977a
CCDB · book-ipcn73-74 — ZHUKOVA, P.G., V.V. PETROVSKY, & T.N. PLIEVA. 1973. The chromosome numbers and taxonomy of some plant species from Siberia and Far East. (in Russian) Bot. zurn. (Moscow & Leningrad) 58: 1331-1342.
CCDB · book-ipcn73-74 — PACKER, J. G., & G.D. MCPHERSON. 1974. Chromosome numbers in some vascular plants from northern Alaska. Canad. J. Bot. 52: 1095-1099.
CCDB · book-indian_vol1 — Holmen, K. 1962 ; Mosquin, T. & Hayley, D.E. 1966 ; Sokolovskaya, A.P. 1968; Zhukova, P.G. (Fedorov); Johnson, A.W. & Packer, J.G. 1968; Mulligan, G.A. & Porsild, A.E. 1969 ; Zhukova,. P.G. & Tikhonova, A.D. 1973 ; Zhukova, P.G. et al. 1973
CCDB · Cave1962 — Holmen 1962
CCDB · Cave1963 — Sokolovskaya 1963
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXV]. Taxon 31(2): 344-360.
2n 181×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — Krogulevich 1971
n 82×CCDB · ipcn-api-dl · CCDB · Cave1963
CCDB · ipcn-api-dl — Spellenberg, R. 1981. Chromosome numbers and their cytotaxonomic significance for North American Astragalus (Fabaceae). Taxon 25: 463–472.
CCDB · Cave1963 — Sorsa 1963c
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness96.8% BUSCO
08Occurrence & distribution
Record type28 513 records
Wild obs. + sensor23 093
Museum / vouchered5 266
Cultivated / captive5
Other149
Origin
Native102
Introduced1
Range
Area of Occupancy AOO49 084 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy63% within 1 km
≤100 m 8 995≤1 km 4 252≤10 km 6 851>10 km 782
20 880 georeferenced · 2 213 without coordinates
Open the mapobservation + sensor23 093
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy31% within 1 km
≤100 m 214≤1 km 637≤10 km 848>10 km 1 033
2 732 georeferenced · 2 534 without coordinates
Open the institutions mapphysical evidence5 266
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced · 4 without coordinates
Open the mapnot free-living5
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions118 of 206 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Helsinki, FI | 653 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 496 |
| LDlocation not on record | 400 |
| Uppsala, SE | 315 |
| Moscow State Universitylocation not on record | 297 |
| Oulu, FI | 157 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 103 |
| Salzburg, AT | 95 |
| Kuopio, FI | 89 |
| Oskarshamn, SE | 88 |
| WTUlocation not on record | 86 |
| Turku, FI | 85 |
| University of Stellenboschlocation not on record | 71 |
| Anchorage, US | 70 |
| Missoula, US | 66 |
| KMNlocation not on record | 66 |
| GJOlocation not on record | 65 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 64 |
| BFLlocation not on record | 60 |
| University of Alberta Museumslocation not on record | 59 |
| Victoria, CA | 59 |
| Zürich, CH | 59 |
| GZUlocation not on record | 58 |
| Vancouver, CA | 55 |
| Chongqing Museumlocation not on record | 54 |
| Trondheim, NO | 52 |
| Zürich, CH | 52 |
| Jyväskylä, FI | 49 |
| Elocation not on record | 37 |
| Spearfish, US | 36 |
| Moscow, US | 36 |
| Rocky Mountain Biological Laboratorylocation not on record | 36 |
| Yukon Universitylocation not on record | 34 |
| SLU Artdatabankenlocation not on record | 33 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 29 |
| Urumqi, CN | 29 |
| Claremont, US | 27 |
| Bern, CH | 26 |
| Urumqi, CN | 24 |
| TROMlocation not on record | 23 |
| Montréal, CA | 22 |
| TUR-Alocation not on record | 22 |
| Stockholm, SE | 21 |
| Barcelona, ES | 20 |
| Bozeman, US | 18 |
| Saint John, CA | 18 |
| BDBClocation not on record | 18 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 17 |
| Rovaniemi, FI | 17 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 17 |
| Université Lavallocation not on record | 17 |
| Albuquerque, US | 17 |
| Bergen, NO | 16 |
| Canadian Museum of Naturelocation not on record | 16 |
| Pocatello, US | 15 |
| BClocation not on record | 15 |
| Adam Mickiewicz University in Poznańlocation not on record | 15 |
| St. Paul, US | 15 |
| Glarus, CH | 15 |
| Québec, CA | 15 |
| BRNUlocation not on record | 15 |
| Beijing, CN | 14 |
| LIVlocation not on record | 14 |
| Yangling, CN | 14 |
| Tromso University Museumlocation not on record | 14 |
| Whitehorse, CA | 14 |
| Institute of the biological problems of the North FEB RASlocation not on record | 13 |
| GMBAlocation not on record | 12 |
| Toronto, CA | 11 |
| Dresden, DE | 11 |
| WINlocation not on record | 11 |
| Bronx, US | 11 |
| Boise, US | 11 |
| Flagstaff, US | 11 |
| Wlocation not on record | 10 |
| Uniwersytet Opolskilocation not on record | 10 |
| Bangkok, TH | 9 |
| ASUlocation not on record | 9 |
| Saint Louis, US | 9 |
| Pullman, US | 9 |
| University of Lethbridgelocation not on record | 9 |
| Olocation not on record | 8 |
| Durango, US | 8 |
| Logan, US | 8 |
| Corvallis, US | 8 |
| Provo, US | 8 |
| Frankfurt am Main | 8 |
| South Kensington, GB | 8 |
| MAlocation not on record | 8 |
| New Haven, US | 8 |
| Denver, US | 7 |
| SZUlocation not on record | 7 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 7 |
| San Luis Obispo, US | 7 |
| Görlitz, DE | 7 |
| Mlocation not on record | 7 |
| Chadron, US | 6 |
| nbflocation not on record | 6 |
| US | 6 |
| Brookings, US | 6 |
| DOI/NPS, Greenbelt Parklocation not on record | 6 |
| Provincia di Livornolocation not on record | 6 |
| Emporia, US | 6 |
| Kew, GB | 6 |
| Riverside, US | 5 |
| West Virginia Wesleyan Collegelocation not on record | 5 |
| Davis, US | 5 |
| Orem, US | 5 |
| Porvoo, FI | 5 |
| CASlocation not on record | 5 |
| Sion, CH | 5 |
| Tartu, EE | 4 |
| Acadia Universitylocation not on record | 4 |
| Göteborg, SE | 4 |
| Bloomington, US | 4 |
| Porrentruy, CH | 4 |
| Paris, FR | 4 |
| University of Hulllocation not on record | 4 |
| Karlsruhe, DE | 3 |
| Natural History Museum Rotterdamlocation not on record | 3 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 3 |
| Wuzhou, CN | 3 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 3 |
| Tilburg, NL | 3 |
| Phoenix, US | 3 |
| NMBU:MINAlocation not on record | 3 |
| Berlin, DE | 3 |
| Churchill Northern Studies Centrelocation not on record | 3 |
| Yellowstone National Park Herbariumlocation not on record | 3 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 3 |
| Royal Botanic Garden Edinburghlocation not on record | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| BIO-UNIPIlocation not on record | 3 |
| Chapel Hill, US | 3 |
| Jena Microbial Resource Collectionlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Kunming, CN | 2 |
| Xiamen, CN | 2 |
| Boumlocation not on record | 2 |
| PTHlocation not on record | 2 |
| Forssa, FI | 2 |
| LfUlocation not on record | 2 |
| BM|NMWlocation not on record | 2 |
| Pittsburg, US | 2 |
| Wellington, NZ | 2 |
| BMlocation not on record | 2 |
| Ann Arbor, US | 2 |
| Ypsilanti, US | 2 |
| Sevilla, ES | 2 |
| Salamanca, ES | 2 |
| Christchurch, NZ | 2 |
| Philadelphia, US | 2 |
| Umeå Universitylocation not on record | 2 |
| Portland, US | 2 |
| Northridge, US | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Durham, US | 2 |
| CJBGlocation not on record | 2 |
| Columbia, US | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| MeiseBGlocation not on record | 2 |
| Dhaka, BD | 2 |
| Minia, EG | 1 |
| San Sebastián, ES | 1 |
| Uniwersytet Wrocławskilocation not on record | 1 |
| Guilin, CN | 1 |
| Lincoln, US | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| Bourges, FR | 1 |
| USFS/BHSClocation not on record | 1 |
| IWEP FEB RASlocation not on record | 1 |
| Lausanne, CH | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| Research Collection of Jonathan Farrlocation not on record | 1 |
| Bend, US | 1 |
| Millersville, US | 1 |
| Edinburgh, GB | 1 |
| Knoxville, US | 1 |
| Davenport, US | 1 |
| E|LIVlocation not on record | 1 |
| Caldwell, US | 1 |
| cslocation not on record | 1 |
| NMWlocation not on record | 1 |
| Dekalb, US | 1 |
| Angwin, US | 1 |
| València, ES | 1 |
| Burlington, US | 1 |
| Mississippi State, US | 1 |
| Monastir, TN | 1 |
| Cambridge, US | 1 |
| PRClocation not on record | 1 |
| US | 1 |
| PVTlocation not on record | 1 |
| San Jose, US | 1 |
| Cslocation not on record | 1 |
| University of New Hampshirelocation not on record | 1 |
| Chicago, US | 1 |
| Tampere, FI | 1 |
| Tacoma, US | 1 |
| Universität Basel, Herbariumlocation not on record | 1 |
| GB | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
206 institutions · 5 157 of 5 266 vouchered records shown · 108 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA53 detections
Where the DNA of Astragalus alpinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found53
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 53 detections have coordinates
Open the map6 countries0
NE facing steep slope, small location with m…Coastal back beach ridge to the lagoon, peri…Alluvial channel in dune system periodically…meadowon rocky outcropHygric Meadow (or Hydric Meadow)
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median9.80 °C 3.80–14.4
Seasonal swing summer↔winter24.7 °C
Max temp (day)12.0 °C 6.90–17.1
Min temp (night)6.20 °C 1.00–10.5
Precipitation80.1 mm/mo 42.3–110
Air humidity62.4 % 57.9–67.7
Moisture balance-9.00 mm/mo
Vapour deficit459 Pa 318–665
Wind speed4.20 m/s
Cloud cover55.8 % 44.1–67.2
CHELSA 1981–2010, ~9 km grid, at location & month of 47 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.