Astraeus pteridis

(Shear) Zeller · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Diplocystidiaceae/Astraeus

At a glance

Occurrence records289

Data sources9

Biological traits0

DNA specimens3

eDNA detections54

Sources9 archives

Databases and archives Astraeus pteridis's data was compiled from.

GBIFGlobal Biodiversity Information Facility289 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI54 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Chemical compositionLOTUS · NPASS30 compounds

Occurrence & distributionGBIF289 records

Environmental DNA2 datasets · 4 countries54 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition30 compounds

Compounds documented for Astraeus pteridis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols11

Lanostane, Tirucallane and Euphane triterpenoids11

Flavan-3-ols4

Proanthocyanins2

Simple phenolic acids1

Documented compounds30 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3R)-2-(2,4,5-trihydroxyphenyl)-8-[(2R,3R,4R)-3,5,7-trihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS
(2S)-2-phenyl-2-(trimethylazaniumyl)acetate	present	LOTUS
(2S,3S)-2-(2,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS
3,5-Dihydroxy-4-oxo-2-(3,4,5-trihydroxyphenyl)-4H-1-benzopyran-7-yl 6-deoxy-alpha-L-mannopyranoside	present	NPASS
3-[(2S,3R,4R,5R,6S)-4,5-dihydroxy-6-methyl-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-5,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)chromen-4-one	present	NPASS
3-Epi-Astrahygrol	present	LOTUS
3-Epi-Astrapteridiol	present	LOTUS
6-[1-(3-hydroxy-4,4,10,13,14-pentamethyl-2,3,5,6,7,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl)ethyl]-3-methyloxan-2-one	present	LOTUS
[(2S,3S,4R,5R)-2-[5,7-dihydroxy-4-oxo-2-(3,4,5-trihydroxyphenyl)chromen-3-yl]oxy-4,5-dihydroxyoxan-3-yl] 3,4,5-trihydroxybenzoate	present	NPASS
alpha-D-Galactose	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astraeus pteridis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences10

eDNA detections54

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPX608789.1 ↗559 bpUSA · 2022

ACGT

CCGAATCTCGGGGGGATGTCTAGTATTTCGGAGTGCTGTCGCTGGCCTTCGGGCAATGTGCACGTCTCCGGAGTCCGACGGCGTCCCCTC …

Astraeus pteridis voucher iNaturalist#139828028 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type289 records

Wild obs. + sensor240

Museum / vouchered49

Range

Area of Occupancy AOO776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 149≤1 km 23≤10 km 15>10 km 12

199 georeferenced · 41 without coordinates

Open the mapobservation + sensor240

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 3≤1 km 2≤10 km 9>10 km 7

21 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence49

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	11
Pullman, US	10
Bernard Price Institute for Palaeontological Researchlocation not on record	4
TUR-Alocation not on record	3
Bronx, US	2
TENN-Flocation not on record	1
Ann Arbor, US	1
Olocation not on record	1
Universidade Federal do Rio Grande do Nortelocation not on record	1
Auckland, NZ	1
ILLSlocation not on record	1
nsnflocation not on record	1
SLU Artdatabankenlocation not on record	1
Catholic University of Pekinglocation not on record	1
Copenhagen, DK	1

15 institutions · 40 of 49 vouchered records shown · 8 without an institution code

09Environmental DNA54 detections

Where the DNA of Astraeus pteridis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found54

Studies independent surveys2

Countries4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 54 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-3.30 °C -3.30–16.4

Seasonal swing summer↔winter22.3 °C

Max temp (day)0 °C 0–19.8

Min temp (night)-8.60 °C -8.60–15.0

Precipitation168 mm/mo 30.5–168

Air humidity57.9 % 56.4–67.3

Moisture balance117 mm/mo -98.6–117

Vapour deficit204 Pa 204–820

Wind speed2.50 m/s 2.50–4.80

Cloud cover50.9 % 34.8–50.9

CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)