Astraeus morganii

Phosri, Watling & M.P.Martín · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Diplocystidiaceae/Astraeus

At a glance

Occurrence records547

Data sources5

Biological traits0

DNA specimens0

eDNA detections554

Sources5 archives

Databases and archives Astraeus morganii's data was compiled from.

GBIFGlobal Biodiversity Information Facility547 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI554 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF547 records

Environmental DNA2 datasets · 3 countries554 detections

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astraeus morganii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences9

eDNA detections554

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPX956816.1 ↗330 bpUSA · 2024

ACGT

ACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTGAAATCTCAAATCCTAGCTTTGCTTTGTCGGAGCTCG …

Astraeus morganii voucher F:C2087212F 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

08Occurrence & distribution

Record type547 records

Wild obs. + sensor545

Museum / vouchered2

Range

Area of Occupancy AOO1 784 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 287≤1 km 44≤10 km 18>10 km 71

420 georeferenced · 125 without coordinates

Open the mapobservation + sensor545

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	1

1 institutions · 1 of 2 vouchered records shown · 1 without an institution code

09Environmental DNA554 detections

Where the DNA of Astraeus morganii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found554

Studies independent surveys2

Countries3

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 554 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.6 °C 10.9–27.8

Seasonal swing summer↔winter16.8 °C

Max temp (day)30.8 °C 15.0–32.8

Min temp (night)23.8 °C 6.80–24.8

Precipitation139 mm/mo 43.7–177

Air humidity61.8 % 51.4–62.0

Moisture balance-38.9 mm/mo -81.3–-7.30

Vapour deficit1,401 Pa 603–1,422

Wind speed2.40 m/s 1.80–4.00

Cloud cover33.8 % 19.6–34.2

CHELSA 1981–2010, ~9 km grid, at location & month of 553 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)