Astilbe japonica

(C.Morren & Decne.) A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Saxifragaceae/Astilbe

At a glance

Occurrence records856

Data sources11

Biological traits11

DNA specimens5

eDNA detections5

Sources11 archives

Databases and archives Astilbe japonica's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility856 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionNPASS17 compounds

Occurrence & distributionGBIF856 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Astilbe japonica, called false buck's beard, is a species of flowering plant in the genus Astilbe, native to Japan, and introduced in New York State. Its hybrid cultivars 'Deutschland', 'Montgomery', and 'Rheinland' have gained the Royal Horticultural Society's Award of Garden Merit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Flowering startDec

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition17 compounds

Compounds documented for Astilbe japonica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Isoquinoline alkaloids11

Isoquinoline alkaloids $ Protopine alkaloids2

Documented compounds17 total

Tissue Source Quantified only

Compound	Amount	Source
(13S)-1,2,4-trimethoxy-12-methyl-13-[[(13R)-1,2,4-trimethoxy-12-methyl-13H-[1,3]benzodioxolo[5,6-c]phenanthridin-13-yl]oxy]-13H-[1,3]benzodioxolo[5,6-c]phenanthridine	present	NPASS
(23S)-23-methoxy-24-methyl-5,7,18,20-tetraoxa-24-azahexacyclo[11.11.0.02,10.04,8.014,22.017,21]tetracosa-1(13),2,4(8),9,11,14(22),15,17(21)-octaene	present	NPASS
(23S)-24-methyl-5,7,18,20-tetraoxa-24-azahexacyclo[11.11.0.02,10.04,8.014,22.017,21]tetracosa-1(13),2,4(8),9,11,14(22),15,17(21)-octaen-23-ol	present	NPASS
1,3-bis[(23S)-24-methyl-5,7,18,20-tetraoxa-24-azahexacyclo[11.11.0.02,10.04,8.014,22.017,21]tetracosa-1(13),2,4(8),9,11,14(22),15,17(21)-octaen-23-yl]propan-2-one	present	NPASS
2,3,7,8,11-pentamethoxy-5-methyl-6H-benzo[c]phenanthridine	present	NPASS
alpha-Allocryptopine	present	NPASS
Chelerythrine	present	NPASS
CNKGXSBPJQHCKK-UHFFFAOYSA-N	present	NPASS
Dihydrochelirubine	present	NPASS
HUCXTEGYYZWPBR-UHFFFAOYSA-N	present	NPASS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astilbe japonica has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences7

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSFJ653639.1 ↗252 bpJapan

ACGT

ATGACTCTCTCCCACGAAACCCGTCCCCGTCATGGGGCGAAGGATTTTACGGAGAGCGGAGAATGGCCTCCCGTGCCGACCATCCGGCGC …

Astilbe japonica voucher A:K. Seto 30390 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Astilbe japonica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 144×CCDB · nw-europe-fl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2540

CCDB · book-fedorov — Schoennagel 1931

CCDB · book-fedorov — Skovsted 1934b

CCDB · book-atlas-flowering-plants — Skovsted 1934b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type856 records

Wild obs. + sensor521

Museum / vouchered321

Cultivated / captive1

Other13

Origin

Introduced104

Range

Area of Occupancy AOO2 428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 259≤1 km 75≤10 km 129>10 km 1

464 georeferenced · 57 without coordinates

Open the mapobservation + sensor521

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 19≤1 km 21≤10 km 7>10 km 1

48 georeferenced · 273 without coordinates

Open the institutions mapphysical evidence321

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tsukuba, JP	68
Sendai, JP	51
Kochi, JP	42
Osaka, JP	24
Tokushima, JP	23
Odawara, JP	10
Nagano City, JP	9
SLU Artdatabankenlocation not on record	9
Chiba, JP	8
Provincia di Livornolocation not on record	8
LDlocation not on record	4
Bergen, NO	3
Oskarshamn, SE	3
Bando, JP	3
Mlocation not on record	3
Hokkaido University Museumlocation not on record	3
Toyama, JP	3
University of Stellenboschlocation not on record	2
Tilburg, NL	2
inatura Erlebnis Naturschau GmbHlocation not on record	2
Dresden, DE	2
Bronx, US	2
JP	2
Salzburg, AT	2
Olocation not on record	2
Otaru, JP	1
SCAUlocation not on record	1
Sanda, JP	1
MeiseBGlocation not on record	1
Auckland, NZ	1
Pullman, US	1
Bern, CH	1
H-Schuhwlocation not on record	1
BFLlocation not on record	1
NoColllocation not on record	1
SIHUlocation not on record	1
Fort Worth, US	1
Sagamihara, JP	1
Kingston, US	1
Dekalb, US	1
Trondheim, NO	1
Tampa, US	1
KMNlocation not on record	1
BSBIlocation not on record	1
Toronto, CA	1

45 institutions · 310 of 321 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Astilbe japonica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–7.40

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C

Min temp (night)3.00 °C

Precipitation344 mm/mo

Air humidity64.9 %

Moisture balance263 mm/mo

Vapour deficit428 Pa

Wind speed2.90 m/s

Cloud cover44.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)