Asterolasia trymalioides

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Asterolasia

At a glance

Occurrence records226

Data sources6

Biological traits38

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Asterolasia trymalioides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility226 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources38 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF226 records

DNA & barcodingNCBIsequences

01Narrative

Asterolasia trymalioides, commonly known as alpine star-bush, is a species of erect, sometimes prostrate shrub that is endemic to eastern Australia. It has leathery, narrow elliptical to circular leaves densely covered with star-shaped hairs on the lower surface, and yellow flowers arranged singly in small groups on the ends of branchlets, the back of the petals covered with brown, star-shaped hairs.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology12

Fruit length4 mm

Leaf length6.5 mm

Leaf length max8 mm

Leaf length min3 mm

Leaf mass per area202 g/m2

Leaf size14.64 mm²

Leaf width4 mm

Leaf width max4 mm

Leaf width min2 mm

Plant height0.8 m

⚠ sources differ — AusTraits: 0.8 m · TRY: 0.071 m

Plant height max1 m

Plant height min0.2 m

Life cycle & reproduction10

Deciduousnessevergreen

Dispersal typeanimal

Flowering timennnnnnnnnnny

Life formsubshrub or shrub

Life spanperennial

Lifespan years45 years

Pollination syndromeinsect

Reproductive maturity5 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical orbicular

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)455 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)5.22 mm²/mg

Other traits1

Plant support typefree-standing

03Chemical composition5 compounds

Compounds documented for Asterolasia trymalioides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Simple coumarins3

Furocoumarins $ Simple coumarins2

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
8-Methoxy-6,7-methylenedioxycoumarin	present	LOTUS
Bergapten	present	LOTUS
Scopoletin	present	LOTUS
Umbelliferone	present	LOTUS
Xanthotoxin	present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asterolasia trymalioides has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP524216.1 ↗703 bpAustralia

ACGT

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTAGCAGAATGACCCGTGAACTTGTCAAAACACCGGAG …

Asterolasia trymalioides isolate R96 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type226 records

Wild obs. + sensor126

Museum / vouchered99

Cultivated / captive1

Origin

Native2

Range

Area of Occupancy AOO476 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 70≤1 km 9≤10 km 10>10 km 1

90 georeferenced · 36 without coordinates

Open the mapobservation + sensor126

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 6≤1 km 23≤10 km 48>10 km 11

88 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence99

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	57
Adelaide, AU	13
La Trobe Universitylocation not on record	8
Hobart, AU	6
Brisbane, AU	4
Parkville, AU	3
Kew, GB	2
Stockholm, SE	1
John T. Waterhouse Herbariumlocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Mount Annan, AU	1
Armidale, AU	1
Canberra, AU	1

13 institutions · 99 of 99 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)