Asterolasia hexapetala

(A.Juss.) Druce · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Asterolasia

At a glance

Occurrence records106

Data sources5

Biological traits30

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Asterolasia hexapetala's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility106 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF106 records

DNA & barcodingNCBIsequences

01Narrative

Asterolasia hexapetala is a species of erect, spreading shrub that is endemic to the Warrumbungles in New South Wales. It has oblong to elliptical leaves with star-shaped hairs, especially on the lower surface, and white flowers arranged in small groups in leaf axils and on the ends of branchlets, the back of the petals densely covered with white, yellow or brown, woolly star-shaped hairs.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Leaf length45 mm

Leaf length max60 mm

Leaf length min20 mm

Leaf width10 mm

Leaf width max15 mm

Leaf width min5 mm

Petiole length1 cm

Plant height3 m

Plant height max3 m

Plant height min1 m

Seed length2.61 mm

Seed mass3.16 mg

Seed mass max3.16 mg

Seed mass min3.16 mg

Seed width1.72 mm

Life cycle & reproduction4

Flowering timennnnnnnnyyyn

Life formshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical oblong

Woodinesswoody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asterolasia hexapetala has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP524208.1 ↗708 bpAustralia

ACGT

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTAGCAGAATGACCCGTGAACTTGTCAAAACACCGGAG …

Asterolasia hexapetala isolate R111 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type106 records

Wild obs. + sensor22

Museum / vouchered82

Cultivated / captive2

Origin

Native16

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 14≤1 km 1≤10 km 2>10 km 1

18 georeferenced · 4 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 5≤1 km 24≤10 km 23>10 km 9

61 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence82

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NSW Dept of Planning, Industry and Environmentlocation not on record	17
Mount Annan, AU	17
Armidale, AU	14
Canberra, AU	14
Museo Entomologico de Leonlocation not on record	9
Adelaide, AU	5
Brisbane, AU	3
Parkville, AU	1
Kew, GB	1

9 institutions · 81 of 82 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)