Asterolasia elegans

L.Mc Dougall & Porteners · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Asterolasia

At a glance

Occurrence records960

Data sources5

Biological traits30

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Asterolasia elegans's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility960 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF960 records

DNA & barcodingNCBIsequences

01Narrative

Asterolasia elegans is a species of slender, erect shrub that is endemic to a restricted area of New South Wales. It has dense, woolly, rusty star-shaped hairs on its stems, lance-shaped leaves densely covered with white and rust-coloured hairs on the lower surface, and white flowers arranged singly or in groups of up to nine in leaf axils or on the ends of branchlets, the back of the petals densely covered with woolly, white hairs.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology12

Fruit length10 mm

Leaf length85 mm

Leaf length max130 mm

Leaf length min40 mm

Leaf width17 mm

Leaf width max25 mm

Leaf width min9 mm

Petiole length1 cm

Plant height3 m

Plant height max3 m

Plant height min1 m

Seed mass4.22 mg

Life cycle & reproduction5

Flowering timennnnnnnnyyyn

Life formshrub

Life spanperennial

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asterolasia elegans has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP524206.1 ↗764 bpAustralia

ACGT

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTAGCAGAATGACCCGTGAACTTGTCAAAACACCGGAG …

Asterolasia elegans isolate R56 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type960 records

Wild obs. + sensor852

Museum / vouchered106

Cultivated / captive2

Origin

Native21

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 840≤1 km 2≤10 km 3>10 km 7

852 georeferenced

Open the mapobservation + sensor852

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 65≤1 km 17≤10 km 5

87 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence106

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NSW Dept of Planning, Industry and Environmentlocation not on record	50
Mount Annan, AU	20
Canberra, AU	8
Museo Entomologico de Leonlocation not on record	6
Brisbane, AU	4
Kew, GB	4
Saint Louis, US	3
Kensington, AU	2
Hobart, AU	2
Adelaide, AU	2
Wollongong, AU	1
Armidale, AU	1
Palmerston, AU	1

13 institutions · 104 of 106 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)