Asterolasia correifolia

(A.Juss.) Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Asterolasia

At a glance

Occurrence records518

Data sources7

Biological traits33

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Asterolasia correifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility518 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF518 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 28

01Narrative

Asterolasia correifolia is a species of erect shrub that is endemic to eastern Australia. It has white to brown star-shaped hairs on its stems, lance-shaped to elliptical leaves densely covered with white star-shaped hairs on the lower surface, and white to cream-coloured or yellow flowers arranged in umbels of four to ten or more in leaf axils, the back of the petals densely covered with white hairs.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length3.75 mm

Fruit width2.75 mm

Leaf length75 mm

Leaf length max90 mm

Leaf length min30 mm

Leaf width28 mm

Leaf width max30 mm

Leaf width min8 mm

Petiole length0.8 cm

Plant height2 m

Plant height max2 m

Plant height min1 m

Seed mass0.95 mg

Seed mass max0.95 mg

Seed mass min0.95 mg

Life cycle & reproduction6

Flowering timennnnnnnnyyyn

Life formshrub

Life spanperennial

Reproductive maturity4 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical ovate widely_elliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asterolasia correifolia has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP524204.1 ↗759 bpAustralia

ACGT

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTAGCAGAATGACCCGTGAACTTGTCAAAACACCGGAG …

Asterolasia correifolia isolate R37 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Asterolasia correifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.953 ↗

08Occurrence & distribution

Record type518 records

Wild obs. + sensor348

Museum / vouchered169

Cultivated / captive1

Origin

Native74

Introduced2

Range

Area of Occupancy AOO996 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 276≤1 km 33≤10 km 10>10 km 9

328 georeferenced · 20 without coordinates

Open the mapobservation + sensor348

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 21≤1 km 27≤10 km 74>10 km 17

139 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence169

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	71
Museo Entomologico de Leonlocation not on record	28
Canberra, AU	23
Brisbane, AU	10
Armidale, AU	8
Wollongong, AU	6
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Parkville, AU	4
Adelaide, AU	4
Hobart, AU	3
Kew, GB	3
John T. Waterhouse Herbariumlocation not on record	1
Kensington, AU	1
Christchurch, NZ	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Smithfield, AU	1

16 institutions · 169 of 169 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)