Asterolasia buxifolia

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Asterolasia

At a glance

Occurrence records790

Data sources5

Biological traits23

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Asterolasia buxifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility790 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Occurrence & distributionGBIF790 records

DNA & barcodingNCBIsequences

01Narrative

Asterolasia buxifolia is a species of spindly shrub in the family Rutaceae and is endemic to a restricted area of eastern New South Wales. It has star-shaped hairs on its stems, leathery leaves and yellow flowers arranged singly in leaf axils with star-shaped hairs on the back of the petals.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Leaf length12.5 mm

Leaf length max18 mm

Leaf length min5 mm

Leaf width6.5 mm

Leaf width max10 mm

Leaf width min3 mm

Petiole length0.45 cm

Plant height1 m

Seed mass1.72 mg

Life cycle & reproduction3

Life formshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapeobovate

Woodinesswoody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asterolasia buxifolia has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP524203.1 ↗764 bpAustralia

ACGT

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTAGCAGAATGACCCGTGAACTTGTCAAAACACCGGAG …

Asterolasia buxifolia isolate ROM 1791 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type790 records

Wild obs. + sensor766

Museum / vouchered21

Cultivated / captive3

Origin

Native9

Introduced1

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 761>10 km 4

765 georeferenced · 1 without coordinates

Open the mapobservation + sensor766

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 7≤1 km 5≤10 km 2>10 km 2

16 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence21

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	8
Museo Entomologico de Leonlocation not on record	7
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Armidale, AU	2
Canberra, AU	2

5 institutions · 21 of 21 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)