Asterolasia buckinghamii

(Blakely) Blakely · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Asterolasia

At a glance

Occurrence records83

Data sources5

Biological traits25

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Asterolasia buckinghamii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility83 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF83 records

DNA & barcodingNCBIsequences

01Narrative

Asterolasia buckinghamii is a species of slender, erect shrub in the family Rutaceae and is endemic to eastern New South Wales. It has star-shaped hairs on its young branches, broadly egg-shaped, hairy leaves and yellow flowers with rust-coloured, star-shaped hairs on the back of the petals.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Leaf length7 mm

Leaf length max10 mm

Leaf length min4 mm

Leaf width4.5 mm

Leaf width max6 mm

Leaf width min3 mm

Plant height2 m

Plant height max2 m

Seed mass1.8 mg

Seed mass max1.8 mg

Seed mass min1.8 mg

Life cycle & reproduction3

Life formshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapewidely_obovate

Woodinesswoody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asterolasia buckinghamii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP524202.1 ↗686 bpAustralia

ACGT

GAAGGATCATTGTCGAAAACTGCCTAGCAGAATGACCCGTGAACTTGTCAAAACACCGGAGGGGGCGTGCCTTGTGTGCGCTCCTCTCCC …

Asterolasia buckinghamii isolate R179 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type83 records

Wild obs. + sensor17

Museum / vouchered63

Cultivated / captive3

Origin

Native23

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 9≤1 km 1≤10 km 3

13 georeferenced · 4 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 18≤1 km 12≤10 km 18>10 km 2

50 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence63

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	23
Museo Entomologico de Leonlocation not on record	19
Canberra, AU	10
Parkville, AU	7
Brisbane, AU	2
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Kensington, AU	1

7 institutions · 63 of 63 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)