Asteridea athrixioides

(Sond. & F.Muell.) Kroner · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Asteridea

At a glance

Occurrence records1 186

Data sources9

Biological traits27

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Asteridea athrixioides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 186 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Occurrence & distributionGBIF1 186 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Asteridea athrixioides is a herb in the Asteraceae family, which is endemic to Australia, and found in Western Australia, South Australia and Victoria. It was first described in 1853 by Otto Sonder and Ferdinand von Mueller as Panaetia athrixioides, who described it from specimen(s) collected in the Port Lincoln district. In 1980, G. Kroner assigned it to the genus, Asteridea, giving it the name Asteridea athrixioides. It is an annual herb, growing on calcareous, sandy or clay soils to heights of from 5 cm to 20 cm. Its yellow flowers may seen from July to November on saline on allvial flats, rocky hills and undulating plains.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFTWCVP

Size & morphology8

Fruit length1 mm

Fruit width0.3 mm

Leaf length25 mm

Leaf width1.5 mm

Plant height0.2 m

Plant height max0.2 m

Plant height min0.05 m

Seed mass0.045 mg

Life cycle & reproduction7

Dispersal typeanimal

Flowering timennnnnnnnyyyn

Life spanannual

Pollination syndromeinsect

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Sex typegynomonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Leaf shapelinear oblanceolate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asteridea athrixioides has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences3

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSAB033313.1 ↗646 bp

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGCGAACATGTAACTAATATCGGGCAACATAGGGATTGAGCCACAACTTGATCCGTATTTGCCTT …

Asteridea athrixioides gene for ITS1, 5.8S ribosomal RNA, ITS2

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Asteridea athrixioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 91×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — TURNER, B.L. 1970. Chromosome numbers in the Compositae. XII Australian species. Amer. J. Bot. 57: 382-389.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 186 records

Wild obs. + sensor605

Museum / vouchered581

Origin

Native468

Range

Area of Occupancy AOO3 276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 371≤1 km 97≤10 km 88>10 km 12

568 georeferenced · 37 without coordinates

Open the mapobservation + sensor605

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 165≤1 km 134≤10 km 196>10 km 41

536 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence581

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	242
Kensington, AU	117
Museo Entomologico de Leonlocation not on record	89
Canberra, AU	44
Mount Annan, AU	6
Brisbane, AU	5
Hobart, AU	5
Kew, GB	4
Stockholm, SE	2
MeiseBGlocation not on record	2
Christchurch, NZ	2
Armidale, AU	2
MAlocation not on record	1
Parkville, AU	1
BGPAlocation not on record	1
Smithfield, AU	1

16 institutions · 524 of 581 vouchered records shown · 57 without an institution code

09Environmental DNA3 detections

Where the DNA of Asteridea athrixioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Asteridea athrixioides

At a glance

Sources9 archives

Size & morphology8

Life cycle & reproduction7

Diet & foraging1

Habitat & environment8

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 186 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 186 records