Aster tongolensis

Franch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Aster

At a glance

Occurrence records268

Data sources11

Biological traits20

DNA specimens2

eDNA detections3

Sources11 archives

Databases and archives Aster tongolensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility268 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF268 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Aster tongolensis is a plant species of the genus Aster. Along with Aster souliei, it has been used in traditional Tibetan medicine for thousands of years as treatment for bronchitis, difficulty in urinating, and hemoptysis caused by tuberculosis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology11

Fruit length2 mm

Fruit length max2 mm

Fruit length min2 mm

Leaf length25 mm

Leaf length max40 mm

Leaf length min10 mm

Leaf width max18 mm

Leaf width min5 mm

Seed mass1.2 mg

Seed mass max1.2 mg

Seed mass min1.2 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max4 000 m

Elevation mean3 400 m

Elevation min2 800 m

Growth formherb

⚠ sources differ — GIFT: herb · TRY: herb/shrub

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: non-woody

03Chemical composition4 compounds

Compounds documented for Aster tongolensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Ursane and Taraxastane triterpenoids1

Shionane triterpenoids1

Stigmastane steroids1

Oleanane triterpenoids1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
Alpha-Amyrin	present	LOTUS
beta-Amyrin	present	LOTUS
beta-Sitosterol	present	LOTUS
Shionone	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aster tongolensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMZ198613.1 ↗403 bp

ACGT

TCGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCTCCCACCATACCTTCCTTCGGGATGGTATGTTGGGGGCGGATAATGG …

Aster tongolensis voucher 1908184 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS7★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aster tongolensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Semple, J. C. 1983. Range expansion of Heterotheca camporum (Compositae: Asteraceae) in the southeastern United States. Brittonia 35(2): 140–146.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type268 records

Museum / vouchered260

Cultivated / captive1

Other7

Range

Area of Occupancy AOO344 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 1≤10 km 7

8 georeferenced · 252 without coordinates

Open the institutions mapphysical evidence260

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

10Collections & institutions

Holding institutions19 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chengdu, CN	87
Beijing, CN	72
Chengdu, CN	19
WNNUlocation not on record	13
Kunming, CN	8
Tianjin Natural History Museumlocation not on record	8
GMBAlocation not on record	7
Xining, CN	6
Guangzhou, CN	5
University of Stellenboschlocation not on record	4
Cambridge, US	4
Taipei, TW	4
Cambridge, US	3
Guilin, CN	3
Edinburgh, GB	3
Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record	2
Fort Worth, US	2
Royal Botanical Gardenslocation not on record	1
Lanzhou, CN	1
Wuhan, CN	1
Montréal, CA	1
Yangling, CN	1
Chengdu, CN	1
Chicago, US	1
Moscow State Universitylocation not on record	1
South Kensington, GB	1

26 institutions · 259 of 260 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Aster tongolensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)