Aster sibiricus — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Aster

At a glance

Occurrence records181

Data sources4

Biological traits5

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Aster sibiricus's data was compiled from.

GBIFGlobal Biodiversity Information Facility181 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources5 traits

Occurrence & distributionGBIF181 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesLEDAGIFTTRY

Life cycle & reproduction2

Dispersal typewind

Life spanperennial

Habitat & environment3

Growth formherb

Mycorrhiza typearbuscular

Woodinessnon-woody

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aster sibiricus has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG219434.1 ↗340 bpCanada · 1999

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Eurybia sibirica voucher BAB-1458 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK4rbcL4ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type181 records

Wild obs. + sensor164

Museum / vouchered17

Range

Area of Occupancy AOO688 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy3% within 1 km

≤1 km 5≤10 km 8>10 km 151

164 georeferenced

Open the mapobservation + sensor164

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institute of Applied Ecology, Academia Sinicalocation not on record	9
Beijing, CN	3
Xining, CN	3
DOI/FWS, Kenai National Wildlife Refugelocation not on record	1
Northeastern Forestry Universitylocation not on record	1

5 institutions · 17 of 17 vouchered records shown