Aster lautureanus

(Debeaux) Franch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Aster

At a glance

Occurrence records29

Data sources9

Biological traits24

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Aster lautureanus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility29 records↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources24 traits

Chemical compositionNPASS4 compounds

Occurrence & distributionGBIF29 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 108

01Narrative

Boltonia lautureana is an East Asian species of plants in the family Asteraceae. It is native to China, Japan, Korea, and Asiatic Russia.Flora of China, 山马兰 shan ma lan, Aster lautureanus (Debeaux) Franchet Boltonia lautureana is a plant up to 100 cm (40 inches) tall. It has many daisy-like flower heads with blue ray florets and yellow disc florets.Debeaux, Jean Odon 1877. Actes de la Société Linnéenne de Bordeaux 31: 215-216 description in Latin, commentary in French

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology15

Fruit length3 mm

Fruit length max3 mm

Fruit length min3 mm

Fruit width2 mm

Fruit width max2 mm

Fruit width min2 mm

Leaf length45 mm

Leaf length max60 mm

Leaf length min30 mm

Leaf width12.5 mm

Leaf width max20 mm

Leaf width min5 mm

Plant height0.75 m

Plant height max1 m

Plant height min0.5 m

Life cycle & reproduction4

Flowering endSep

Flowering startJul

Life formperennial

Life spanperennial

Habitat & environment5

Climatetemperate

Climberself-supporting

Growth formherb

Habitat GIFTmeadows, shrubberies

Woodinessnon-woody

03Chemical composition4 compounds

Compounds documented for Aster lautureanus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Depsidones3

Depsides1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
Atranorin	present	NPASS
Oxyphysodic Acid	present	NPASS
Physodalic acid	present	NPASS
Physodic Acid	present	NPASS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aster lautureanus has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMT731680.1 ↗614 bp

ACGT

TCGAAGCCTGCAAAGCAGAACGACCCGGAACATGTTATAACACCATGCCATGATGGGTTGAGCGTTGTTCGATCCATGTGGCACACCGTT …

Aster lautureanus voucher LWP1308011 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aster lautureanus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 108 n = 54

Ploidydiploid inferred

Chromosome records18–1082n range63median108mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — CHOUKSANOVA, N.A., L.I. SVESHNIKOVA, & T.V. ALEXANDROVA. 1968. A new evidence on chromosome numbers in species of the family Compositae Giseke. Citologija 10: 381-386.

2n 1081×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Gu, H. y. 1989. On chromosome numbers of Kalimeris (Astereae, Asteraceae) and some related taxa. Cathaya 1: 1–16.

n 91×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Rostovtseva, T. S. 1979a. Chromosome numbers of some species of the family Asteraceae Dumort. Bot. Zhurn. SSSR 64 (4): 582–589.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type29 records

Wild obs. + sensor5

Museum / vouchered24

Origin

Native1

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 1

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 3≤10 km 1

4 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Herbarium of the Department of Botany, University of Tokyolocation not on record	5
IWEP FEB RASlocation not on record	5
Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record	4
KR	3
Beijing, CN	2
Tianjin Natural History Museumlocation not on record	2
Vancouver, CA	1
Kyoto Universitylocation not on record	1
Nanjing, CN	1

9 institutions · 24 of 24 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)