Aster koraiensis

Nakai · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Aster

At a glance

Occurrence records412

Data sources10

Biological traits1

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Aster koraiensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility412 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Chemical compositionLOTUS · NPASS65 compounds

Occurrence & distributionGBIF412 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 144

01Narrative

Miyamayomena koraiensis (Korean:벌개미취), commonly called Korean starwort, is a herbaceous perennial plant of the family Asteraceae (Compositae). It can be found in temperate regions, mostly in Korea, in lawns, on roadsides, and other areas with moist soils. Korean starwort is a Korean endemic plant and was first named in the genus Aster in 1909. In Korea, its young leaves are used in food preparation.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Habitat & environment1

Climatetemperate

03Chemical composition65 compounds

Compounds documented for Aster koraiensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Fatty alcohols14

Flavonols13

Cinnamic acids and derivatives9

Friedelane triterpenoids6

Eudesmane sesquiterpenoids5

Documented compounds65 total

Tissue Source Quantified only

Compound	Amount	Source
(2E,8S,9Z)-heptadeca-2,9,16-trien-4,6-diyn-8-ol	present	LOTUS
(2R,3R,4S,5S,6R)-2-[(E)-dec-8-en-4,6-diynoxy]-6-[[(2R,3R,4R)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxymethyl]oxane-3,4,5-triol	present	LOTUS
(2R,3R,4S,5S,6R)-2-[(E,3R)-3-hydroxydec-8-en-4,6-diynoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2R,3R,4S,5S,6R)-2-[(E,3S)-3-hydroxydec-8-en-4,6-diynoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2R,3R,4S,5S,6R)-2-[[(1R,2R,4R,4aR,5R,8aS)-4,5-dihydroxy-4a,8-dimethyl-2-propan-2-yl-2,3,4,5,6,8a-hexahydro-1H-naphthalen-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2R,3R,4S,5S,6R)-2-[[(1R,4S,4aR,8aR)-4-hydroxy-4,8a-dimethyl-6-propan-2-yl-1,2,3,4a,5,8-hexahydronaphthalen-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2R,3R,4S,5S,6R)-2-[[(1R,4S,4aR,8aR)-4-hydroxy-4,8a-dimethyl-6-propan-2-yl-1,2,3,4a,7,8-hexahydronaphthalen-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2R,3R,4S,5S,6R)-2-[[(1S,2S,4R,4aR,5R,8aS)-4,5-dihydroxy-2-(2-hydroxypropan-2-yl)-4a,8-dimethyl-2,3,4,5,6,8a-hexahydro-1H-naphthalen-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2R,3S)-2-(3,4-dihydroxyphenyl)-8-[(2R,3S,4S)-2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,4-dihydro-2H-chromen-4-yl]-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS
(2R,3S,4S)-2-(3,4-dihydroxyphenyl)-4-[(2R,3S)-2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,4-dihydro-2H-chromen-8-yl]-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aster koraiensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ587597.1 ↗629 bp

ACGT

TCGAAGCCTGCAAAGCAGAACGACCCGTGAACATGTTATAACCACCATGCCATGATGGGTTGAGCGTTAGTTCGATCCTGTGGCACACCG …

Aster koraiensis isolate 123 voucher WC Lee 0021323 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aster koraiensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 144 n = 72

Chromosome records18–1442n range144median144mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1443×CCDB · book-atlas-flowering-plants · CCDB · Cave1956supp · CCDB · Cave1958

CCDB · book-atlas-flowering-plants — Shimotomai & H. '42 - "

CCDB · Cave1956supp — Huziwara 1954b

CCDB · Cave1958 — Huziwara 1958a

2n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ito, M., A. Soejima & K. Watanabe. 1998. Phylogenetic relationships of Japanese aster (Asteraceae, Astereae) sensu lato based on chloroplast-DNA restriction site mutations. J. Pl. Res. 111: 217–223.

08Occurrence & distribution

Record type412 records

Wild obs. + sensor331

Museum / vouchered80

Cultivated / captive1

Origin

Introduced1

Range

Area of Occupancy AOO1 148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 9≤1 km 1

10 georeferenced · 321 without coordinates

Open the mapobservation + sensor331

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 3≤10 km 15

18 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence80

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Institute of Biological Resourceslocation not on record	23
NSMKlocation not on record	20
KR	12
Herbarium of the Department of Botany, University of Tokyolocation not on record	6
Shinshu Universitylocation not on record	4
Kyoto Universitylocation not on record	4
DNSMlocation not on record	3
Nagano City, JP	2
Beijing, CN	1
Kagoshima, JP	1
Chiba, JP	1
Tsukuba, JP	1
Kochi, JP	1

13 institutions · 79 of 80 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Aster koraiensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 12.6–12.6

Seasonal swing summer↔winter27.3 °C

Max temp (day)16.4 °C

Min temp (night)7.40 °C

Precipitation112 mm/mo

Air humidity58.0 %

Moisture balance21.7 mm/mo

Vapour deficit690 Pa

Wind speed2.90 m/s

Cloud cover41.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)