Aster iinumae

Kitam. ex Hara, 1952 · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Aster

At a glance

Occurrence records416

Data sources6

Biological traits5

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Aster iinumae's data was compiled from.

GBIFGlobal Biodiversity Information Facility416 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources5 traits

Occurrence & distributionGBIF416 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesTRYGIFT

Size & morphology3

Seed mass0.65 mg

Seed mass max0.65 mg

Seed mass min0.65 mg

Habitat & environment2

Growth formherb

⚠ sources differ — GIFT: herb · TRY: herb/non-woody

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aster iinumae has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLC482300.1 ↗685 bpJapan · 2014

ACGT

AGGATCATTGTCGAAGCCTGCAAAGCAGAACGACCCGTGAACATGTTATAACAACCATGCCATGATGGGTTGAGCGTTAGTTCGATCCAT …

Aster iinumae Soejima140805 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type416 records

Wild obs. + sensor71

Museum / vouchered345

Range

Area of Occupancy AOO1 184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy32% within 1 km

≤100 m 15≤10 km 25>10 km 7

47 georeferenced · 24 without coordinates

Open the mapobservation + sensor71

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 1≤1 km 7≤10 km 10

18 georeferenced · 327 without coordinates

Open the institutions mapphysical evidence345

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odawara, JP	187
Tomioka, JP	69
Toyota city nature sanctuarylocation not on record	16
Sanda, JP	11
KR	10
Herbarium of the Department of Botany, University of Tokyolocation not on record	10
Hiratsuka City Museumlocation not on record	9
Sagamihara, JP	9
Parthenon Tama History Museumlocation not on record	9
Akita Prefectural Museumlocation not on record	5
Kawasaki Shi Tama Ku, JP	3
Beijing, CN	2
Elocation not on record	2
National Institute of Biological Resourceslocation not on record	1
Wlocation not on record	1
Taipei, TW	1

16 institutions · 345 of 345 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Aster iinumae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)