Aster alpinus
speciesAt a glance
Occurrence records41 604
Data sources13
Biological traits133
DNA specimens16
eDNA detections77
Sources13 archives
Databases and archives Aster alpinus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility41 604 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI77 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics16 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources133 traits
Chemical compositionLOTUS · NPASS77 compounds
Occurrence & distributionGBIF41 604 records
Environmental DNA2 datasets · 4 countries77 detections
DNA & barcodingBOLD · NCBI16 specimens
Genome at a glanceCCDB · GoaT3.2 Gbp
01Narrative
L'Aster des Alpes ou Reine-marguerite des Alpes est une espèce de plantes à fleurs de la famille des Asteraceae et du genre Aster.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology20
Fruit length3 mm
Fruit length max3 mm
Fruit length min3 mm
Fruit width1.1 mm
Fruit width max1.2 mm
Fruit width min1 mm
Leaf length53.12 mm
Leaf length max100 mm
Leaf length min10 mm
Leaf size127 mm²
Leaf width max15 mm
Leaf width min2 mm
Plant height0.077 m
⚠ sources differ — GIFT: 0.077 m · LEDA: 0.065 m · USDA: 0.091 m · TRY: 0.037 m
Plant height generative0.088 m
Plant height max0.36 m
Plant height min0.06 m
Seed length8.99 mm
Seed mass1.05 mg
⚠ sources differ — TRY: 1.05 mg · LEDA: 0.86 mg · GIFT: 18.86 mg
Seed mass max1.35 mg
Seed mass min1.3 mg
Life cycle & reproduction34
After harvest regrowth rateSlow
Bloom periodEarly Summer
Coppice potentialNo
DeciduousnessN
⚠ sources differ — TRY: N · GIFT: evergreen
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flower colourwhite
Flower conspicuousYes
Flowering endAug
Flowering startAug
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDASlow
Life formperennial
Life spanperennial
Lifespan categoryLong
Lifespan years11 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Resprout abilityNo
Seed spread rateSlow
Seedling vigorLow
Self fertilizationpresent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment29
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatesubalpine or subarctic
Climberself-supporting
Elevation max2 600 m
Elevation mean1 983 m
Elevation min1 500 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Growth formherb
Growth form USDASingle Crown
Habitat GIFTAlluvial deposits on slopes of ridges, on calcareous soils.
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min15 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry27
Anaerobic toleranceNone
C:N ratioMedium
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementLow
Fire resistantNo
Fire toleranceMedium
Frost free days min90 days
Leaf C:N ratio19.43 g/g
Leaf c451 mg/g
Leaf dry-matter content (LDMC)312 mg/g
Leaf n24.94 mg/g
Leaf p1.53 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max36 in
Precipitation min18 in
Protein potentialLow
Salinity toleranceLow
Seed longevity index0
Shade toleranceMedium
Soil pH max7.5 pH
Soil pH min6 pH
Specific leaf area (SLA)15.69 mm²/mg
Temperature min-28 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound8 000 000 per lb
ToxicityNone
Veneer productNo
Other traits7
Diaspore typefruit
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max4 800 per acre
Planting density min3 450 per acre
03Chemical composition77 compounds
Compounds documented for Aster alpinus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Taraxerane triterpenoids7
Simple coumarins4
Unsaturated fatty acids4
Stigmastane steroids4
Oleanane triterpenoids4
Documented compounds77 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,2R,4bR,6R,7R,8aS)-2-ethenyl-1,6,7-trihydroxy-2,4b,8,8-tetramethyl-1,5,6,7,8a,9-hexahydrophenanthren-3-one | present | NPASS | |
| (1R,2R,4bR,7S,8aS)-2-ethenyl-1,7-dihydroxy-2,4b,8,8-tetramethyl-5,7,8a,9-tetrahydro-1H-phenanthrene-3,6-dione | present | NPASS | |
| (1R,2R,7R,9R,10R)-7-(furan-3-yl)-2-hydroxy-9-methyl-6,16-dioxatetracyclo[8.7.0.01,14.04,9]heptadeca-3,13-diene-5,15-dione | present | LOTUS | |
| (1R,4S,6S,9S,10S,13S)-6-hydroxy-5,5,9,13-tetramethyltetracyclo[11.2.1.01,10.04,9]hexadec-14-ene-7,12-dione | present | NPASS | |
| (2R,4aR,6aR,6bR,8aR,10R,12aR,14aS,14bR)-10-hydroxy-2,4a,6b,9,9,12a,14a-heptamethyl-1,3,4,5,6a,7,8,8a,10,11,12,13,14,14b-tetradecahydropicene-2-carboxylic acid | present | NPASS | |
| (2R,4aR,6aR,6bR,8aR,12aR,14aS,14bR)-2,4a,6b,9,9,12a,14a-heptamethyl-10-oxo-3,4,5,6a,7,8,8a,11,12,13,14,14b-dodecahydro-1H-picene-2-carboxylic acid | present | NPASS | |
| (3S,8S,9S,10R,13R,14R,17R)-17-[(E,1R,4S)-4-ethyl-1,5-dimethyl-hex-2-enyl]-8,10,13-trimethyl-1,2,3,4,7,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-ol | present | NPASS | |
| (4aS,6aR,6bS,8aR,12aR,14aS,14bR)-4,4,6a,6b,8a,11,11,14b-octamethyl-2,4a,5,6,7,8,9,10,12,12a,14,14a-dodecahydro-1H-picen-3-one | present | NPASS | |
| (8S,9S,10R,13R,14S,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-1,2,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-3-one | present | NPASS | |
| 2-((6-O-(beta-D-apiofuranosyl)beta-D-glucopyranosyl)oxy)propane | present | NPASS |
05DNA & barcoding16 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aster alpinus has left across the world's sequence archives.
At a glance
DNA specimens16
Marker genes5
GenBank sequences10
eDNA detections77
Countries4
The DNA barcodea real sequence read deposited for this species
ACGCATCGCGTCGCTCCCACCATTCCTTCTTTCGGGATGCTTGGTTGGGGGCGGATAATGGCCTCCCGTTCCTCACCGAGCGGTTGGCCA …
Aster alpinus voucher ZX-6119 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★ITS5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Aster alpinus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size3 239 625 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Aster alpinus3.24 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records18–362n range18median18mode70records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1844×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · iapt +8
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — FAVARGER C. - 1965. Notes de caryologie alpine. IV.. Bull. Soc. Neuchateloise Sci. Nat. , 88: 60.
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · fl-europaea — Favarger &
CCDB · ipcn-api-dl — Jones, A. G. & R. A. Smogor. 1983. Chromosome counts of and notes on some Old World Asters (Asteraceae). Phytologia 53: 429–432.
CCDB · ipcn-api-dl — Krasnikov, A. A. 1984. In R.E. Krogulevich & T.S. Rostovtseva, Khromosomnye Chisla Tsvetkovykh Rastenii i Sibiri Dal'nego Vostoka. Izdatel'stvo "Nauka", Sibirskoe Otdelenie, Novosibirsk. ý.
CCDB · ipcn-api-dl — Kuzmanov, B. A., S. B. Georgieva & V. A. Nikolova. 1986. Chromosome numbers of Bulgarian flowering plants. I. Fam. Asteraceae. Fitologija 31: 71–74.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1984. Khrom. Chisla Tsvet. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Chinnappa, C. C. & J. G. Chmielewski. 1987. Documented plant chromosome numbers 1987: 1. Miscellaneous counts from western North America. Sida 12: 409–417.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1983. Accessory chromosomes in some plant species. Citol. Genet. (Kiev). 17(3): 8–12.
CCDB · ipcn-api-dl — Volkova, S. A. & E. V. Boyko. 1986. Chromosome numbers in some species of Asteraceae from the southern part of the Soviet far east. Bot. Zhurn. 71: 1693.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk
CCDB · ipcn-api-dl — Krasnikova, S. A., R. E. Krogulevich & T. S. Rostovtseva. 1984. In R.E. Krogulevich & T.S. Rostovtseva, Khromosomnye Chisla Tsvetkovykh Rastenii i Sibiri Dal'nego Vostoka. Izdatel'stvo "Nauka", Sibirskoe Otdelenie, Novosibirsk. ý.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1991. Chromosome numbers in some species of vascular plants from the Pechoro-Ilychsky Reservation (Komi ASSR). Bot. Žhurn. (Moscow & Leningrad) 76: 473–476.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & L. G. Ulle. 1992. Kariologicheskie osobennosti i rasprostranenie predstavitelej semejstva Asteraceae v Pechoro--Ilychskom Biosfernom Zapovednike. Trudy Komi Nauchnogo Tsentra UrO AN SSSR 126: 52–64.
CCDB · ipcn-api-dl — Huber, W. & M. Baltisberger. 1992. IOPB chromosome data 4. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 18/19: 6–8.
CCDB · ipcn-api-dl — Mĕsíček, J. & J. Soják. 1992. Chromosome numbers of Mongolian angiosperms. I. Preslia 64: 193–206.
CCDB · ipcn-api-dl — Baltisberger, M. 1992. Botanische Notizen und zytologische Untersuchungen an einigen Pflanzen (insbesondere aus den Gattungen Ranunculus und Achillea) aus dem albanisch-jugoslawischen Grenzgebiet (Korab, Sar Planina). Ber. Geobot. Inst. ETH Stiftung Rübel 58: 192–211.
CCDB · ipcn-api-dl — Murín, A. 1993. Karyologické atúdium okrasn@3ych rastlín flóry Slovenska. Biologia (Bratislava) 48: 441–445.
CCDB · ipcn-api-dl — Krasnikov, A. A. & E. A. Korolyuk. 1995. Chromosome numbers in some members of the family Asteraceae from Siberian flora. Bot. Žhurn. (Moscow & Leningrad) 80(4): 107.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1979a. Chromosome numbers of some species of the family Asteraceae Dumort. Bot. Zhurn. SSSR 64 (4): 582–589.
CCDB · ipcn-api-dl — Andreev, V. N. 1981. In Chromosome number reports LXX. Taxon 30: 74–75.
CCDB · ipcn-api-dl — Uhrikova, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — Uhrikova, A. & J. Majovsky. 1977. In IOPB chromosome number reports LVI. Taxon 26: 257–274.
CCDB · ipcn-api-dl — Baltisberger. 2006. Cytological investigations on Bulgarian phanerogams. Willdenowia 36(Special Issue): 205–216.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. Pp. 19-48 in L. I. Malyshev & G. A. Peshlcova (eds.) Flora of the Prebaikal. Novosibirsk.
CCDB · book-ipcn66 — Zhukova 1966
CCDB · book-ipcn67-71 — FAVARGER, C., & P. KUPFER. 1968. Contribution a la cytotaxinomie de la flore alpine des Pyrenees. Collect. Bot. 7: 325-352.
CCDB · book-ipcn67-71 — ZHUKOVA, P.G . & A.D. TIKHONOVA. 1971. Chromosome numbers of certain plant species indigenous to the Chukotsky province. (In Russian). Bot. Zurn. 56: 868-875.
CCDB · eflora
CCDB · book-atlas-flowering-plants — Sakai 1935
CCDB · iapt — IAPT/IOPB Chromosome Data 17
CCDB · Cave1963 — Sokolovskaya 1963
CCDB · CromoCat 2015 — Provontova, N. S & Kazanovsky, S .G & Rudyka, E.G & Barkalov, V.Y & Seledets, V.P & Nechaev, V.A (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1790-1794
CCDB · CromoCat 2015 — Andreev, N. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXX]. Taxon 30(1): 74-75.
CCDB · CromoCat 2015 — Guinochet, M. & Lefranc, M. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 853-854.
CCDB · CromoCat 2015 — Huber, W. & Baltisberger, M. (1992). IOPB Chromosome Data 4 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 18/19: 6-8.
CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S. & Nikolova, V. (1986). Chromosome numbers of Bulgarian flowering plants. I, Fam. Asteraceae. Fitologija 31: 71-74.
CCDB · CromoCat 2015 — Probatova, N. S., Seledets, V. P. & Rudyka, E. G. (2008). IAPT/IOPB Chromosome Data 5 Taxon 57(2): 553-562
+3 more references
2n 3626×CCDB · ita-fl · CCDB · slov-fl · CCDB · fl-europaea +6
CCDB · ita-fl — Baltisberger M., Kurg K., Widmer A. - 1999 (1997). Cytological data of some plant species from Italy.. Archivio Geobotanico , 2(2): 133-142.
CCDB · ita-fl — FAVARGER C. - 1991. Liens gntiques entre la flore orophile des Tratas et celle des Alpes la lumire de quelques complexes polyploides.. Polish. Bot. Stud. , 2: 23-38.
CCDB · ita-fl — FAVARGER C. - 1975. IOPB chromosome number reports L.. Taxon , 24(5/6): 672.
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Favarger C., 1959: Notes de caryologie alpine. III. - Bull. Soc. Neuchâteloise Sci. Nat. 82: 255-285.
CCDB · fl-europaea — Favarger, 1959a
CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.
CCDB · ipcn-api-dl — Krasnikova, S. A., A. A. Krasnikov, T. S. Rostovtzeva & V. M. Chanminchun. 1983. Chromosome numbers of some plant species from the south of Siberia. Bot. Zhurn. SSSR 68 (6): 827–835. (In Russian).
CCDB · ipcn-api-dl — Yurtsev, B. A. & P. G. ZHUKOVA. 1982. Chromosome numbers of some plants of the northeastern Yakutia (the drainage of the Indigirka River in its middle reaches). Bot. Zhurn. 67 (6): 778–787. (In Russian).
CCDB · ipcn-api-dl — Baden, C. 1983. Chromosome numbers in some Greek angiosperms. Willdenowia 13: 335–336.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1980. Chromosome numbers of some Southern Chukotka plant species. Bot. Zhurn. 65 (1): 51–59.
CCDB · ipcn-api-dl — Guinochet, M. & M. Lefranc. 1981. In Chromosome number reports LXXIII. Taxon 30: 853–854.
CCDB · ipcn-api-dl — Murin, A. & J. Majovsky. 1979. Karyological study of Slovakian flora I. Acta Fac. Rerum Nat. Univ. Comeninae, Bot. 27: 127–133.
CCDB · ipcn-api-dl — Favarger, C. 1975a. In IOPB chromosome number reports L. Taxon 24: 671–678.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Chromosome numbers of plant species from the Tunkinsky Alpes (East Sayan). News Sib. Depart. Acad. Sci. USSR, Ser. Biol. 15(3): 46–52.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. Pp. 19-48 in L. I. Malyshev & G. A. Peshlcova (eds.) Flora of the Prebaikal. Novosibirsk.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · book-atlas-flowering-plants — S. & S. 1933
CCDB · Cave1959 — Skalinska et al. 1959
CCDB · CromoCat 2015 — Baden, C. (1983). Chromosome numbers in some Greek Angiosperms. Willdenowia 13: 335-336.
CCDB · CromoCat 2015 — Favarger, C. (1997). Notes de caryologie alpienne VI Bulletin de la Société Neuchâteloise de Sciences Naturelles 120: 19-33
CCDB · CromoCat 2015 — Krasnikova, S. A., Kransnikov, A. A., Rostovtzeva, T. S. & Chanminchun, V. M. (1983). Chromosome numbers of some plant species from the South of Siberia. Bot. Žurn. 68: 827-835.
CCDB · CromoCat 2015 — Favarger, C. (1975c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports L]. Taxon 24(5/6): 672.
2n 272×CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — CHOUKSANOVA, N.A., L.I. SVESHNIKOVA, & T.V. ALEXANDROVA. 1968. Data on karyology of the family Compositae Giseke. Citologija 10: 198-206.
CCDB · CromoCat 2015 — Zakirova, R. O. & I. I. Nafanailova. (1988). Chromosome numbers in members of some families of the Kazakhstan flora Botani?eskij Žurnal (Moscow & Leningrad) 73: 452-453
2n 371×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Favarger, C. (1997). Notes de caryologie alpienne VI Bulletin de la Société Neuchâteloise de Sciences Naturelles 120: 19-33
n 04×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Provontova, N. S & Kazanovsky, S .G & Rudyka, E.G & Barkalov, V.Y & Seledets, V.P & Nechaev, V.A (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1790-1794
CCDB · CromoCat 2015 — Baden, C. (1983). Chromosome numbers in some Greek Angiosperms. Willdenowia 13: 335-336.
CCDB · CromoCat 2015 — Favarger, C. (1997). Notes de caryologie alpienne VI Bulletin de la Société Neuchâteloise de Sciences Naturelles 120: 19-33
CCDB · CromoCat 2015 — Krasnikova, S. A., Kransnikov, A. A., Rostovtzeva, T. S. & Chanminchun, V. M. (1983). Chromosome numbers of some plant species from the South of Siberia. Bot. Žurn. 68: 827-835.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type41 604 records
Wild obs. + sensor38 433
Museum / vouchered2 725
Cultivated / captive13
Other433
Range
Area of Occupancy AOO38 352 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy36% within 1 km
≤100 m 8 714≤1 km 2 473≤10 km 18 503>10 km 1 054
30 744 georeferenced · 7 689 without coordinates
Open the mapobservation + sensor38 433
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy44% within 1 km
≤100 m 69≤1 km 513≤10 km 674>10 km 67
1 323 georeferenced · 1 402 without coordinates
Open the institutions mapphysical evidence2 725
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤100 m 1≤1 km 3
4 georeferenced · 9 without coordinates
Open the mapnot free-living13
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions70 of 144 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 471 |
| Zürich, CH | 405 |
| Zürich, CH | 275 |
| Salzburg, AT | 108 |
| BFLlocation not on record | 73 |
| GJOlocation not on record | 72 |
| Uniwersytet Wrocławskilocation not on record | 64 |
| Barcelona, ES | 61 |
| IB FRC Komi SC UB RASlocation not on record | 54 |
| University of Alberta Museumslocation not on record | 50 |
| Vitoria, ES | 48 |
| BDBClocation not on record | 44 |
| Beijing, CN | 39 |
| Urumqi, CN | 39 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 37 |
| BRNUlocation not on record | 34 |
| LDlocation not on record | 33 |
| Bern, CH | 31 |
| València, ES | 30 |
| Wlocation not on record | 30 |
| BClocation not on record | 29 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 28 |
| GZUlocation not on record | 27 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 26 |
| Oskarshamn, SE | 24 |
| Chengdu, CN | 23 |
| Adam Mickiewicz University in Poznańlocation not on record | 22 |
| San Sebastián, ES | 18 |
| Berlin, DE | 16 |
| MAlocation not on record | 16 |
| SZUlocation not on record | 15 |
| Görlitz, DE | 14 |
| Stockholm, SE | 14 |
| Glarus, CH | 13 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 13 |
| Entomological Society of Latvialocation not on record | 13 |
| Jiangxi College of Educationlocation not on record | 12 |
| Salamanca, ES | 11 |
| Shanghai, CN | 11 |
| Pechora-Ilych Nature Reservelocation not on record | 11 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 10 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 10 |
| Bronx, US | 10 |
| College of the Atlantic, Museumlocation not on record | 9 |
| Porrentruy, CH | 9 |
| CJBGlocation not on record | 8 |
| Madrid, ES | 7 |
| Denver, US | 7 |
| Sion, CH | 6 |
| 东北师范大学自然博物馆location not on record | 6 |
| Uniwersytet Śląski w Katowicachlocation not on record | 6 |
| Alicante, ES | 5 |
| Dresden, DE | 5 |
| University of Stellenboschlocation not on record | 5 |
| Pamplona, ES | 5 |
| Provincia di Livornolocation not on record | 5 |
| Saint Louis, US | 4 |
| Yukon Universitylocation not on record | 4 |
| Inner Mongolia Universitylocation not on record | 4 |
| Nanjing, CN | 4 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 4 |
| Urumqi, CN | 4 |
| BG-NMNHSlocation not on record | 3 |
| Frankfurt am Main | 3 |
| Davis, US | 3 |
| PRClocation not on record | 3 |
| Badajoz, ES | 3 |
| IWEP FEB RASlocation not on record | 3 |
| WTUlocation not on record | 3 |
| Bourges, FR | 3 |
| Granada, ES | 3 |
| Museo Achille Folettolocation not on record | 3 |
| Chengdu, CN | 3 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 3 |
| Montréal, CA | 3 |
| Research Collection of B. A. Bennettlocation not on record | 3 |
| Sant Julià de Lòria, AD | 2 |
| Philadelphia, US | 2 |
| Uniwersytet Warszawskilocation not on record | 2 |
| Pullman, US | 2 |
| Victoria, CA | 2 |
| Albuquerque, US | 2 |
| Chongqing Museumlocation not on record | 2 |
| Nanjing, CN | 2 |
| Kunming, CN | 2 |
| Auckland, NZ | 2 |
| Cambridge, US | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| Emporia, US | 2 |
| Edinburgh, GB | 2 |
| Trondheim, NO | 2 |
| Boise, US | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Boumlocation not on record | 2 |
| Samara National Research Universitylocation not on record | 2 |
| Mlocation not on record | 2 |
| Durham, US | 2 |
| Xian, CN | 2 |
| Gijón, ES | 1 |
| Kew, GB | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| ROM007location not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| QAUlocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Paris, FR | 1 |
| Herb. BBGlocation not on record | 1 |
| Dhaka, BD | 1 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 1 |
| Podgorica, ME | 1 |
| Göteborg, SE | 1 |
| Missoula, US | 1 |
| Canadian Museum of Naturelocation not on record | 1 |
| Dekalb, US | 1 |
| JBAlocation not on record | 1 |
| Spearfish, US | 1 |
| Toronto, CA | 1 |
| Lanzhou, CN | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| Helsinki, FI | 1 |
| IPE-CSIClocation not on record | 1 |
| Olocation not on record | 1 |
| Riverside, US | 1 |
| Shanxi Institute of Biologylocation not on record | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| WNNUlocation not on record | 1 |
| Beijing, CN | 1 |
| Guangzhou, CN | 1 |
| Acadia Universitylocation not on record | 1 |
| Yangling, CN | 1 |
| Shanxi Universitylocation not on record | 1 |
| Xining, CN | 1 |
| Xian, CN | 1 |
| CICYTEXlocation not on record | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| SCAUlocation not on record | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| MeiseBGlocation not on record | 1 |
| University of Lethbridgelocation not on record | 1 |
| Tilburg, NL | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
144 institutions · 2 623 of 2 725 vouchered records shown · 99 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA77 detections
Where the DNA of Aster alpinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found77
Studies independent surveys2
Countries4
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 77 detections have coordinates
Open the map4 countries0
Dry southern exposed rocky slope above Picea…Mesic Dwarf Shrub Tundra dominated by Empetr…Barren slopes and summits, dried brighter.Throughout bluffs surrounding Albert Creek. …
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median8.80 °C 8.80–10.2
Seasonal swing summer↔winter26.2 °C
Max temp (day)12.9 °C 12.9–14.6
Min temp (night)3.60 °C 3.60–5.40
Precipitation81.9 mm/mo 81.9–98.4
Air humidity57.2 % 57.2–61.5
Moisture balance-24.1 mm/mo -24.1–-4.30
Vapour deficit484 Pa 480–484
Wind speed3.10 m/s 3.10–4.20
Cloud cover17.1 % 17.1–23.8
CHELSA 1981–2010, ~9 km grid, at location & month of 73 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.