Astartoseris triquetra

(Labill.) N.Kilian, Hand, Hadjik., Christodoulou & Bou Dagh. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Astartoseris

At a glance

Occurrence records13

Data sources8

Biological traits1

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Astartoseris triquetra's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF13 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2 Gbp

01Narrative

Astartoseris is a monotypic genus of flowering plants belonging to the family Asteraceae. It only contains one known species, 'Astartoseris triquetra' It is native to Cyprus, Lebanon and Syria. The genus name of Astartoseris is in honour of Astarte, the Hellenized form of the Ancient Near Eastern goddess Ashtart or Athtart (Northwest Semitic), a deity closely related to Ishtar (East Semitic), worshipped from the Bronze Age through classical antiquity. The Latin specific epithet of triquetra means three cornered. Both the genus and the species were first described and published in Willdenowia Vol.47 on page 120 in 2017.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Habitat & environment1

Climatesubtropical

03Chemical composition4 compounds

Compounds documented for Astartoseris triquetra across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavones2

Simple coumarins1

Flavonols1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
Apigenin	present	LOTUS
Cichoriin	present	LOTUS
Luteolin 7-diglucoside	present	LOTUS
Quercetin	present	LOTUS

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astartoseris triquetra has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences8

The DNA barcodea real sequence read deposited for this species

ITSLT722047.1 ↗640 bp

ACGT

TCGAACCCTGCAAGGCAGAACGACCTGTGAACATGTAACTACAATCGGGTGATAGGGAAATGGGCCTTGGTCCTAATCCCTCAACCCCTC …

Lactuca triquetra genomic DNA sequence contains ITS1, 5.8S rRNA gene and ITS2, isolate LAC-276, specimen voucher M. Cubr 38916 (B)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS6

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Astartoseris triquetra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 004 899 999 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Astartoseris triquetra2 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Kilian. 2004. In R. Hand (ed.), Supplementary notes to the flora of Cyprus IV. Willdenowia 34: 427–456.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type13 records

Wild obs. + sensor2

Museum / vouchered11

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 11 records without

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wlocation not on record	10
Berlin, DE	1

2 institutions · 11 of 11 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)