Astartea fascicularis

(Labill.) A.Cunn. ex DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Astartea

At a glance

Occurrence records268

Data sources9

Biological traits31

DNA specimens4

eDNA detections4

Sources9 archives

Databases and archives Astartea fascicularis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility268 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF268 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Astartea leptophylla, commonly known as river-bank astartea, is a plant endemic to Western Australia. The spreading tree or shrub can grow to a height of 5 m. It blooms between December and March producing white flowers. It is found along the south coast on river valleys, river banks, floodways, seasonally wet sites and estuaries in the South West and Great Southern regions of Western Australia where it grows in sandy-loamy soils over granite.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology12

Fruit length1.55 mm

Leaf length8 mm

Leaf width0.5 mm

Petiole length0.06 cm

Plant height1 m

Plant height max3 m

Plant height min0.3 m

Seed length0.8 mm

Seed mass3.89 mg

⚠ sources differ — TRY: 3.89 mg · AusTraits: 0.081 mg · GIFT: 7.69 mg

Seed mass max7.69 mg

Seed mass min7.69 mg

Seed width0.425 mm

Life cycle & reproduction6

Flowering timeyynnnnnnnnny

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapeobovate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition2 compounds

Compounds documented for Astartea fascicularis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Gallotannins2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
3-Methylellagic acid		present	LOTUS
Ellagic acid		present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Astartea fascicularis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences5

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKM065019.1 ↗709 bp

ACGT

TGCGGAAGGATCATTGTCGAATCCTGCGAGGCAGAACGACCAGAGAACCGGTTAAAAACCAAATGGGGGGCGGCGGGTTCCGCCCGACGT …

Astartea fascicularis M91 AK281556 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type268 records

Wild obs. + sensor79

Museum / vouchered188

Cultivated / captive1

Origin

Native16

Introduced2

Range

Area of Occupancy AOO740 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 7≤1 km 62≤10 km 9>10 km 1

79 georeferenced

Open the mapobservation + sensor79

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 17≤1 km 26≤10 km 66>10 km 38

147 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence188

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	56
Canberra, AU	30
Kensington, AU	21
Mount Annan, AU	15
Brisbane, AU	13
Kew, GB	10
Adelaide, AU	8
Auckland, NZ	5
Christchurch, NZ	4
Rotorua, NZ	4
MAlocation not on record	4
Canadian Department of Agriculturelocation not on record	3
Hobart, AU	3
BGPAlocation not on record	2
Smithfield, AU	1
Armidale, AU	1
LDlocation not on record	1
La Trobe Universitylocation not on record	1
Stockholm, SE	1
Riverside, US	1
Parkville, AU	1

21 institutions · 185 of 188 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Astartea fascicularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)