Asplenium vespertinum — The Life Data

Plantae/Tracheophyta/Polypodiopsida/Polypodiales/Aspleniaceae/Asplenium

At a glance

Occurrence records286

Data sources7

Biological traits7

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Asplenium vespertinum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility286 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF286 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Asplenium vespertinum is a species of fern known by the common name western spleenwort. It is native to southern California and Baja California, where it grows in moist, shady, rocky places, such as the shadows beneath cliff overhangs. The leaves grow in dense clusters and are up to about 30 centimeters long. Each is made up of 20 to 30 narrow leaflets with lobed edges. There are a few sori on the underside of each leaflet.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Asplenium vespertinum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMK827052.1 ↗1 232 bpUSA

ACGT

TTATTACACCCCCGAATACAAGACTAAAGAGACTGATATCTTGGCAGCTTTTCGGATGACCCCACAACCCGGAGTACCAGCTGAAGAAGC …

Asplenium vespertinum voucher Rothfels 2554 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1rbcLa

plant barcode

08Occurrence & distribution

Record type286 records

Wild obs. + sensor109

Museum / vouchered177

Origin

Native20

Range

Area of Occupancy AOO816 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 109

109 georeferenced

Open the mapobservation + sensor109

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 9≤1 km 45≤10 km 56>10 km 8

118 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence177

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	61
Claremont, US	22
Los Angeles, US	14
CASlocation not on record	11
Philadelphia, US	6
Chicago, US	5
Irvine, US	5
Santa Barbara, US	4
Riverside, US	4
Flagstaff, US	3
WTUlocation not on record	3
Severin-McDaniel Insect Collectionlocation not on record	3
San Francisco, US	3
Bloomington, US	2
McWane Science Centerlocation not on record	2
South Kensington, GB	2
Durham, US	2
Wellington, NZ	1
San Luis Obispo, US	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Saint Louis, US	1
Pullman, US	1
US	1
Fullerton, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Auckland, NZ	1
Arcata, US	1
US	1
Ann Arbor, US	1
Bronx, US	1
Mexico City, MX	1
St. Paul, US	1

32 institutions · 167 of 177 vouchered records shown · 10 without an institution code

09Environmental DNA1 detections

Where the DNA of Asplenium vespertinum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

Riparian/Canyon vegetation with Salix lasiol…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 16.2–16.2

Seasonal swing summer↔winter14.9 °C

Max temp (day)23.9 °C

Min temp (night)9.50 °C

Precipitation11.8 mm/mo

Air humidity55.7 %

Moisture balance-149 mm/mo

Vapour deficit823 Pa

Wind speed3.60 m/s

Cloud cover26.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.